Incidental Mutation 'R2073:Vmn2r109'
ID227374
Institutional Source Beutler Lab
Gene Symbol Vmn2r109
Ensembl Gene ENSMUSG00000090572
Gene Namevomeronasal 2, receptor 109
SynonymsEG627814
MMRRC Submission 040078-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R2073 (G1)
Quality Score220
Status Not validated
Chromosome17
Chromosomal Location20540517-20564756 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 20564712 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 15 (K15N)
Ref Sequence ENSEMBL: ENSMUSP00000132641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167093]
Predicted Effect probably benign
Transcript: ENSMUST00000167093
AA Change: K15N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000132641
Gene: ENSMUSG00000090572
AA Change: K15N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 83 467 1.4e-35 PFAM
Pfam:NCD3G 510 563 3.1e-21 PFAM
Pfam:7tm_3 596 831 7.4e-52 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik A G 4: 41,507,519 probably null Het
2310057M21Rik T C 7: 131,357,513 R153G probably benign Het
4930430A15Rik T C 2: 111,200,418 E382G probably damaging Het
5730596B20Rik C A 6: 52,178,982 Y9* probably null Het
9130011E15Rik A T 19: 45,965,381 I188K probably damaging Het
Aco1 G A 4: 40,183,605 G508S probably damaging Het
Acot3 A G 12: 84,053,456 H2R possibly damaging Het
Adamts13 T A 2: 27,006,314 C1240S probably damaging Het
Adra1b T C 11: 43,835,871 N73S probably damaging Het
Aebp2 G A 6: 140,633,694 S219N probably benign Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Ank T C 15: 27,565,022 S270P probably benign Het
Ankle1 G A 8: 71,409,329 R492H possibly damaging Het
Ankub1 G A 3: 57,692,292 H19Y possibly damaging Het
Anln C A 9: 22,333,168 W1083L probably benign Het
Apaf1 G T 10: 91,031,694 S763* probably null Het
Apba3 A G 10: 81,269,294 T134A probably benign Het
Bod1l C T 5: 41,819,189 S1594N probably benign Het
C7 T C 15: 4,990,428 M746V probably benign Het
Cdkn2a T A 4: 89,294,493 I11F possibly damaging Het
Cideb T C 14: 55,755,160 M100V possibly damaging Het
Cntnap5c T C 17: 58,305,552 L862P possibly damaging Het
Coch A T 12: 51,602,689 D261V probably benign Het
Cyp2ab1 A G 16: 20,313,889 F220L possibly damaging Het
Ddx10 A T 9: 53,240,505 D73E probably benign Het
Dgkg A G 16: 22,565,317 F462S probably damaging Het
Dlgap3 C T 4: 127,195,366 H252Y probably damaging Het
Dmd G C X: 84,312,483 A2257P probably benign Het
Dtnb A G 12: 3,781,273 T658A probably benign Het
Duox2 T A 2: 122,295,158 S323C probably damaging Het
Dync1h1 T A 12: 110,614,592 I251N probably damaging Het
Eml5 A G 12: 98,802,446 S1457P probably damaging Het
Fam114a1 T A 5: 64,995,904 probably null Het
Fcho1 A T 8: 71,710,489 L632Q probably damaging Het
Gm12695 T C 4: 96,723,945 Y527C possibly damaging Het
Gm16223 T C 5: 42,214,599 C111R unknown Het
H2-Q4 T A 17: 35,380,402 S154T possibly damaging Het
Hhat A G 1: 192,727,379 F125L possibly damaging Het
Ier5l T A 2: 30,473,056 D319V probably damaging Het
Kif5a T C 10: 127,245,369 D232G probably damaging Het
M1ap A G 6: 82,981,882 I165V probably benign Het
Map2k4 A C 11: 65,693,456 F334V probably damaging Het
Mmp19 G A 10: 128,794,979 R156H probably damaging Het
Mpped2 T A 2: 106,744,802 Y77* probably null Het
Nhs T A X: 161,842,721 H544L probably damaging Het
Nr4a1 C A 15: 101,274,067 H541N probably damaging Het
Olfr1247 A G 2: 89,609,478 V208A probably benign Het
Olfr1484 A T 19: 13,585,601 Q99L probably damaging Het
Pak6 A C 2: 118,688,851 N17T probably damaging Het
Pcnt T A 10: 76,380,380 T2225S possibly damaging Het
Pdzd2 A G 15: 12,385,819 L955P probably damaging Het
Phf21a A G 2: 92,348,036 D357G probably damaging Het
Pih1d3 A G 1: 31,222,996 S20G probably benign Het
Pkhd1l1 G T 15: 44,558,639 A3102S probably damaging Het
Plch2 A T 4: 154,989,909 L754Q probably damaging Het
Plekhd1 A G 12: 80,721,292 N335D probably benign Het
Pole C A 5: 110,325,551 T1737N probably damaging Het
Pramel6 G A 2: 87,508,744 S96N probably damaging Het
Prdm14 A C 1: 13,125,730 Y36D possibly damaging Het
Psg27 T C 7: 18,560,417 D355G probably damaging Het
Rfc1 A T 5: 65,301,939 D225E probably damaging Het
Sec16a A G 2: 26,440,239 I588T probably damaging Het
Setd6 G A 8: 95,716,788 V60M probably damaging Het
Sgk3 A G 1: 9,891,424 I432V probably benign Het
Six2 A G 17: 85,687,505 S150P probably damaging Het
Slc1a6 T C 10: 78,800,130 V343A possibly damaging Het
Slc43a3 T C 2: 84,944,612 probably null Het
Smc3 A G 19: 53,631,533 D620G probably benign Het
Smg6 C G 11: 74,930,294 P464A probably damaging Het
Sox11 T C 12: 27,342,279 T44A possibly damaging Het
Spata22 A G 11: 73,336,226 R89G possibly damaging Het
Stk3 T C 15: 34,959,049 M256V possibly damaging Het
Syne2 A G 12: 76,015,579 D4226G possibly damaging Het
Tecpr2 T C 12: 110,968,429 S1370P possibly damaging Het
Tek A G 4: 94,827,729 I463V probably benign Het
Trib1 T A 15: 59,654,340 I253N probably damaging Het
Triobp G T 15: 78,973,895 G1232V probably damaging Het
Trpm6 G A 19: 18,876,042 V1809M probably damaging Het
Tsc22d4 A G 5: 137,762,487 K57E possibly damaging Het
Wdr78 G A 4: 103,050,193 T632M probably damaging Het
Wnt9a A G 11: 59,331,229 N318D probably damaging Het
Wwp1 A G 4: 19,662,181 V138A possibly damaging Het
Zfp37 A T 4: 62,191,708 M411K probably damaging Het
Zfp715 T A 7: 43,311,120 T16S probably benign Het
Zfp932 A G 5: 110,009,818 T461A possibly damaging Het
Zscan29 A T 2: 121,160,855 C817* probably null Het
Other mutations in Vmn2r109
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01313:Vmn2r109 APN 17 20550157 missense probably damaging 1.00
IGL01383:Vmn2r109 APN 17 20541121 missense possibly damaging 0.89
IGL01469:Vmn2r109 APN 17 20541409 missense probably damaging 1.00
IGL01762:Vmn2r109 APN 17 20554392 missense probably benign
IGL01864:Vmn2r109 APN 17 20541134 missense probably benign 0.28
IGL02028:Vmn2r109 APN 17 20541080 missense probably benign 0.28
IGL02074:Vmn2r109 APN 17 20554341 missense probably benign 0.05
IGL02162:Vmn2r109 APN 17 20554160 missense probably benign 0.01
IGL02474:Vmn2r109 APN 17 20540888 missense probably benign
IGL02490:Vmn2r109 APN 17 20540984 missense possibly damaging 0.78
IGL02604:Vmn2r109 APN 17 20540701 missense probably damaging 1.00
IGL02669:Vmn2r109 APN 17 20554256 missense possibly damaging 0.64
IGL02705:Vmn2r109 APN 17 20553800 missense probably benign
IGL02745:Vmn2r109 APN 17 20541250 missense probably damaging 0.99
PIT4142001:Vmn2r109 UTSW 17 20554577 critical splice acceptor site probably null
R0389:Vmn2r109 UTSW 17 20541074 missense probably damaging 1.00
R0470:Vmn2r109 UTSW 17 20552886 missense probably benign 0.06
R0570:Vmn2r109 UTSW 17 20540675 missense probably damaging 0.99
R0855:Vmn2r109 UTSW 17 20541408 nonsense probably null
R0882:Vmn2r109 UTSW 17 20554580 splice site probably benign
R1241:Vmn2r109 UTSW 17 20555241 missense possibly damaging 0.86
R1587:Vmn2r109 UTSW 17 20540740 missense probably damaging 1.00
R1931:Vmn2r109 UTSW 17 20553810 nonsense probably null
R1957:Vmn2r109 UTSW 17 20564707 missense probably benign 0.11
R1962:Vmn2r109 UTSW 17 20553923 missense probably damaging 0.99
R2020:Vmn2r109 UTSW 17 20541186 nonsense probably null
R2436:Vmn2r109 UTSW 17 20554536 missense probably damaging 0.99
R3123:Vmn2r109 UTSW 17 20540986 missense probably damaging 1.00
R3839:Vmn2r109 UTSW 17 20554442 missense probably damaging 1.00
R4019:Vmn2r109 UTSW 17 20553812 missense probably benign
R4428:Vmn2r109 UTSW 17 20553024 missense probably benign
R4584:Vmn2r109 UTSW 17 20554558 nonsense probably null
R4652:Vmn2r109 UTSW 17 20541394 missense probably damaging 1.00
R4708:Vmn2r109 UTSW 17 20541343 missense probably damaging 0.97
R4823:Vmn2r109 UTSW 17 20553891 missense probably damaging 1.00
R4831:Vmn2r109 UTSW 17 20541232 missense probably benign 0.01
R4907:Vmn2r109 UTSW 17 20550086 missense probably damaging 1.00
R5011:Vmn2r109 UTSW 17 20555189 missense probably damaging 1.00
R5296:Vmn2r109 UTSW 17 20554341 missense possibly damaging 0.90
R5600:Vmn2r109 UTSW 17 20540927 missense probably damaging 1.00
R5602:Vmn2r109 UTSW 17 20540671 missense possibly damaging 0.94
R5652:Vmn2r109 UTSW 17 20540519 makesense probably null
R5702:Vmn2r109 UTSW 17 20554145 missense probably benign 0.42
R5706:Vmn2r109 UTSW 17 20554305 missense probably benign 0.16
R5714:Vmn2r109 UTSW 17 20552859 missense probably damaging 1.00
R5832:Vmn2r109 UTSW 17 20541056 missense probably benign 0.10
R6008:Vmn2r109 UTSW 17 20540719 missense probably damaging 1.00
R6334:Vmn2r109 UTSW 17 20541178 missense probably benign 0.18
R6377:Vmn2r109 UTSW 17 20564534 critical splice donor site probably null
R6738:Vmn2r109 UTSW 17 20554523 missense possibly damaging 0.52
R6857:Vmn2r109 UTSW 17 20540670 missense probably benign 0.45
R6953:Vmn2r109 UTSW 17 20540711 missense possibly damaging 0.95
R7108:Vmn2r109 UTSW 17 20564744 missense probably benign 0.03
R7229:Vmn2r109 UTSW 17 20540963 missense possibly damaging 0.80
R7238:Vmn2r109 UTSW 17 20541074 missense probably damaging 1.00
R7244:Vmn2r109 UTSW 17 20540683 missense possibly damaging 0.70
R7292:Vmn2r109 UTSW 17 20541438 missense probably benign 0.05
R7354:Vmn2r109 UTSW 17 20540781 missense probably damaging 1.00
R7357:Vmn2r109 UTSW 17 20541274 missense probably damaging 1.00
R7522:Vmn2r109 UTSW 17 20554403 missense probably benign 0.11
R7596:Vmn2r109 UTSW 17 20540680 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCAACAAAGTCAGGCTGAGATTAAG -3'
(R):5'- AATACAGGGCCTCAGCTGTAG -3'

Sequencing Primer
(F):5'- ATTTCATTCCCCCTGAGAGAGG -3'
(R):5'- GCTGTAGAGCCCAAGAGAAATTG -3'
Posted On2014-09-17