Incidental Mutation 'R2074:Olfr1247'
ID227399
Institutional Source Beutler Lab
Gene Symbol Olfr1247
Ensembl Gene ENSMUSG00000075081
Gene Nameolfactory receptor 1247
SynonymsMOR231-6, GA_x6K02T2Q125-51051555-51050611
MMRRC Submission 040079-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R2074 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location89604959-89614130 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89609478 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 208 (V208A)
Ref Sequence ENSEMBL: ENSMUSP00000149408 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099771] [ENSMUST00000111532] [ENSMUST00000216424]
Predicted Effect probably benign
Transcript: ENSMUST00000099771
AA Change: V208A

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000097359
Gene: ENSMUSG00000075081
AA Change: V208A

DomainStartEndE-ValueType
Pfam:7tm_1 39 285 4.9e-29 PFAM
Pfam:7tm_4 137 278 4.2e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111532
AA Change: V208A

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000107157
Gene: ENSMUSG00000075081
AA Change: V208A

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 1.2e-48 PFAM
Pfam:7tm_1 39 285 1.6e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216424
AA Change: V208A

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A T 4: 42,974,171 D1168V probably benign Het
4930430A15Rik T C 2: 111,200,418 E382G probably damaging Het
9130011E15Rik A T 19: 45,965,381 I188K probably damaging Het
Ace C T 11: 105,976,623 Q484* probably null Het
Ackr3 T C 1: 90,213,981 I54T probably damaging Het
Aco1 G A 4: 40,183,605 G508S probably damaging Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Ankef1 T C 2: 136,545,738 S192P possibly damaging Het
Ankrd16 T G 2: 11,789,748 C315G possibly damaging Het
Ankzf1 T C 1: 75,196,243 S328P probably damaging Het
Aqp2 A G 15: 99,583,100 I176V probably benign Het
Arhgap45 A G 10: 80,027,180 Y730C probably damaging Het
Asxl2 A G 12: 3,493,779 E316G probably damaging Het
Btbd17 A T 11: 114,791,952 probably null Het
Calu A G 6: 29,372,615 Y263C probably damaging Het
Ccdc122 T C 14: 77,068,951 probably null Het
Cenpf T C 1: 189,656,901 K1578R probably damaging Het
Cep120 A G 18: 53,719,312 V498A possibly damaging Het
Ces1a T A 8: 93,048,075 N12Y probably benign Het
Chmp1a A T 8: 123,208,022 M65K probably damaging Het
Cnot1 G T 8: 95,739,833 T1592K possibly damaging Het
Cps1 T A 1: 67,204,638 I1091N probably benign Het
Dhx32 T C 7: 133,721,292 N731S probably benign Het
Dhx33 G A 11: 70,999,843 R177W probably damaging Het
Dmd G C X: 84,312,483 A2257P probably benign Het
Dnah10 T C 5: 124,814,674 S3259P probably damaging Het
Dnah7a T C 1: 53,457,696 I3134V probably benign Het
Dock3 A G 9: 106,993,463 F584S possibly damaging Het
Dtnb A G 12: 3,781,273 T658A probably benign Het
Duox2 T A 2: 122,295,158 S323C probably damaging Het
Elovl3 A T 19: 46,132,167 E33V probably damaging Het
Enpp5 T C 17: 44,085,373 F392S probably benign Het
Eogt T C 6: 97,131,376 T235A probably benign Het
Etv3 T C 3: 87,536,219 V370A probably benign Het
Ewsr1 C T 11: 5,071,555 R466H unknown Het
Fam208a T A 14: 27,461,213 I543K probably benign Het
Fcgbp G A 7: 28,120,389 G2514S probably damaging Het
Flt1 A T 5: 147,599,606 D808E possibly damaging Het
Glg1 C T 8: 111,168,671 G836E probably damaging Het
Gm17334 A G 11: 53,772,828 probably benign Het
Gpbp1 A T 13: 111,453,407 D51E probably benign Het
Il12rb2 C G 6: 67,360,552 C115S probably damaging Het
Il1rl1 T C 1: 40,462,044 S527P probably damaging Het
Ireb2 A G 9: 54,881,449 D69G probably benign Het
Kif5a T C 10: 127,245,369 D232G probably damaging Het
M1ap A G 6: 82,981,882 I165V probably benign Het
Mff T A 1: 82,751,700 L287H probably damaging Het
Mmp27 A G 9: 7,577,739 M311V possibly damaging Het
Mpped2 T A 2: 106,744,802 Y77* probably null Het
Mybbp1a G A 11: 72,441,445 S21N probably benign Het
Obscn G C 11: 59,069,281 I3253M probably damaging Het
Obscn T C 11: 59,132,652 D633G probably damaging Het
Olfr1404 A T 1: 173,215,810 D53V probably damaging Het
Olr1 C T 6: 129,502,094 V54I probably benign Het
Phlpp2 T C 8: 109,928,492 S605P possibly damaging Het
Plekhg4 TAGTCGATGCCCGAGTC TAGTC 8: 105,376,452 probably benign Het
Prss8 C A 7: 127,927,094 R148L possibly damaging Het
Psg27 T C 7: 18,560,417 D355G probably damaging Het
Rabgef1 C A 5: 130,187,561 Q52K probably benign Het
Rnf6 C T 5: 146,210,906 R434H probably damaging Het
Rpl26 A G 11: 68,903,273 E88G probably benign Het
Rpn1 T A 6: 88,100,962 L460Q probably damaging Het
Sap130 T A 18: 31,648,279 I165N probably damaging Het
Sash1 A G 10: 8,756,697 V258A probably damaging Het
Scarb1 G T 5: 125,294,143 N288K probably benign Het
Sec16a A G 2: 26,440,239 I588T probably damaging Het
Shank2 C A 7: 144,409,540 S295Y probably damaging Het
Slc15a3 T C 19: 10,857,299 S515P probably damaging Het
Slc25a13 A T 6: 6,114,017 M285K probably benign Het
Slc39a11 A G 11: 113,463,974 I143T probably null Het
Smarcd2 A T 11: 106,265,307 L42* probably null Het
Smc3 A G 19: 53,631,533 D620G probably benign Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Taar4 A C 10: 23,961,173 Q227P probably benign Het
Tecta G T 9: 42,337,279 Y1937* probably null Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tmem130 T A 5: 144,755,274 T107S possibly damaging Het
Tmem132d T C 5: 128,269,131 D109G probably damaging Het
Tmem81 A G 1: 132,507,906 Y150C probably damaging Het
Tnrc18 C T 5: 142,759,706 probably null Het
Trim43a A G 9: 88,586,094 K256R possibly damaging Het
Trpm6 A G 19: 18,877,739 T1921A probably damaging Het
Tubb3 C T 8: 123,421,270 A314V probably damaging Het
Ube3b A C 5: 114,415,255 N896T probably benign Het
Unc80 G A 1: 66,679,744 probably null Het
Upb1 A G 10: 75,424,513 T134A probably damaging Het
Vmn2r15 A T 5: 109,286,753 M695K possibly damaging Het
Wwc1 G T 11: 35,889,353 D258E possibly damaging Het
Zfp619 T A 7: 39,534,761 Y72N probably benign Het
Zfp672 G T 11: 58,316,636 H286Q possibly damaging Het
Other mutations in Olfr1247
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01101:Olfr1247 APN 2 89609847 missense probably benign 0.00
IGL01337:Olfr1247 APN 2 89609376 missense probably damaging 0.97
IGL02537:Olfr1247 APN 2 89609395 missense possibly damaging 0.88
IGL02651:Olfr1247 APN 2 89609498 missense possibly damaging 0.67
IGL02734:Olfr1247 APN 2 89609959 missense probably benign 0.04
IGL03177:Olfr1247 APN 2 89609482 missense probably benign 0.03
IGL03184:Olfr1247 APN 2 89609568 missense probably damaging 1.00
R0207:Olfr1247 UTSW 2 89609863 missense probably damaging 0.97
R0278:Olfr1247 UTSW 2 89609763 missense probably damaging 1.00
R0278:Olfr1247 UTSW 2 89609764 missense probably damaging 1.00
R0601:Olfr1247 UTSW 2 89609220 missense probably benign 0.00
R0633:Olfr1247 UTSW 2 89609374 missense probably benign 0.10
R1824:Olfr1247 UTSW 2 89609349 missense probably damaging 1.00
R1863:Olfr1247 UTSW 2 89609709 nonsense probably null
R2073:Olfr1247 UTSW 2 89609478 missense probably benign 0.01
R2075:Olfr1247 UTSW 2 89609478 missense probably benign 0.01
R3921:Olfr1247 UTSW 2 89609509 missense probably benign 0.00
R4559:Olfr1247 UTSW 2 89609699 missense probably damaging 0.99
R5128:Olfr1247 UTSW 2 89609303 missense probably damaging 1.00
R5140:Olfr1247 UTSW 2 89609283 missense probably damaging 1.00
R5426:Olfr1247 UTSW 2 89609739 missense probably damaging 1.00
R5896:Olfr1247 UTSW 2 89609323 missense probably damaging 0.98
R5902:Olfr1247 UTSW 2 89609251 missense probably damaging 1.00
R6478:Olfr1247 UTSW 2 89609446 missense probably damaging 1.00
R7143:Olfr1247 UTSW 2 89610019 missense probably benign 0.00
R7221:Olfr1247 UTSW 2 89609928 missense probably damaging 1.00
R7599:Olfr1247 UTSW 2 89609227 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GGATTCAACATGGGAGTAATAGCTG -3'
(R):5'- GGGGATTTGCACATGCTCTG -3'

Sequencing Primer
(F):5'- AACCATGATGTGGGAGCT -3'
(R):5'- TGCACATGCTCTGGTTCAAG -3'
Posted On2014-09-17