Incidental Mutation 'R2074:Ube3b'
ID 227410
Institutional Source Beutler Lab
Gene Symbol Ube3b
Ensembl Gene ENSMUSG00000029577
Gene Name ubiquitin protein ligase E3B
Synonyms
MMRRC Submission 040079-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2074 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 114518668-114559230 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 114553316 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Threonine at position 896 (N896T)
Ref Sequence ENSEMBL: ENSMUSP00000073652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074002] [ENSMUST00000130169]
AlphaFold Q9ES34
Predicted Effect probably benign
Transcript: ENSMUST00000074002
AA Change: N896T

PolyPhen 2 Score 0.139 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000073652
Gene: ENSMUSG00000029577
AA Change: N896T

DomainStartEndE-ValueType
IQ 28 50 1.17e-2 SMART
low complexity region 310 327 N/A INTRINSIC
low complexity region 412 428 N/A INTRINSIC
low complexity region 470 488 N/A INTRINSIC
HECTc 697 1070 2.15e-110 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130169
SMART Domains Protein: ENSMUSP00000138723
Gene: ENSMUSG00000029577

DomainStartEndE-ValueType
IQ 28 50 1.17e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150630
Predicted Effect probably benign
Transcript: ENSMUST00000196651
SMART Domains Protein: ENSMUSP00000143455
Gene: ENSMUSG00000029577

DomainStartEndE-ValueType
HECTc 122 495 1.1e-112 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: E1 ubiquitin-activating enzymes, E2 ubiquitin-conjugating enzymes, and E3 ubiquitin-protein ligases. This gene encodes a member of the E3 ubiquitin-conjugating enzyme family which accepts ubiquitin from an E2 ubiquitin-conjugating enzyme and transfers the ubiquitin to the targeted substrates. A HECT (homology to E6-AP C-terminus) domain in the C-terminus of the longer isoform of this protein is the catalytic site of ubiquitin transfer and forms a complex with E2 conjugases. Shorter isoforms of this protein which lack the C-terminal HECT domain are therefore unlikely to bind E2 enzymes. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit preweaning lethality, reduced fertility, decreased growth, reduced grip strength, impaired hearing, eye inflammation and decreased cholesterol level. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace C T 11: 105,867,449 (GRCm39) Q484* probably null Het
Ackr3 T C 1: 90,141,703 (GRCm39) I54T probably damaging Het
Aco1 G A 4: 40,183,605 (GRCm39) G508S probably damaging Het
Akap8l C T 17: 32,551,457 (GRCm39) R511H probably damaging Het
Ankef1 T C 2: 136,387,658 (GRCm39) S192P possibly damaging Het
Ankrd16 T G 2: 11,794,559 (GRCm39) C315G possibly damaging Het
Ankzf1 T C 1: 75,172,887 (GRCm39) S328P probably damaging Het
Aqp2 A G 15: 99,480,981 (GRCm39) I176V probably benign Het
Arhgap45 A G 10: 79,863,014 (GRCm39) Y730C probably damaging Het
Armh3 A T 19: 45,953,820 (GRCm39) I188K probably damaging Het
Asxl2 A G 12: 3,543,779 (GRCm39) E316G probably damaging Het
Btbd17 A T 11: 114,682,778 (GRCm39) probably null Het
Calu A G 6: 29,372,614 (GRCm39) Y263C probably damaging Het
Ccdc122 T C 14: 77,306,391 (GRCm39) probably null Het
Cenpf T C 1: 189,389,098 (GRCm39) K1578R probably damaging Het
Cep120 A G 18: 53,852,384 (GRCm39) V498A possibly damaging Het
Ces1a T A 8: 93,774,703 (GRCm39) N12Y probably benign Het
Chmp1a A T 8: 123,934,761 (GRCm39) M65K probably damaging Het
Cnot1 G T 8: 96,466,461 (GRCm39) T1592K possibly damaging Het
Cps1 T A 1: 67,243,797 (GRCm39) I1091N probably benign Het
Dhx32 T C 7: 133,323,021 (GRCm39) N731S probably benign Het
Dhx33 G A 11: 70,890,669 (GRCm39) R177W probably damaging Het
Dmd G C X: 83,356,089 (GRCm39) A2257P probably benign Het
Dnah10 T C 5: 124,891,738 (GRCm39) S3259P probably damaging Het
Dnah7a T C 1: 53,496,855 (GRCm39) I3134V probably benign Het
Dock3 A G 9: 106,870,662 (GRCm39) F584S possibly damaging Het
Dtnb A G 12: 3,831,273 (GRCm39) T658A probably benign Het
Duox2 T A 2: 122,125,639 (GRCm39) S323C probably damaging Het
Elovl3 A T 19: 46,120,606 (GRCm39) E33V probably damaging Het
Enpp5 T C 17: 44,396,264 (GRCm39) F392S probably benign Het
Eogt T C 6: 97,108,337 (GRCm39) T235A probably benign Het
Etv3 T C 3: 87,443,526 (GRCm39) V370A probably benign Het
Ewsr1 C T 11: 5,021,555 (GRCm39) R466H unknown Het
Fcgbp G A 7: 27,819,814 (GRCm39) G2514S probably damaging Het
Flt1 A T 5: 147,536,416 (GRCm39) D808E possibly damaging Het
Glg1 C T 8: 111,895,303 (GRCm39) G836E probably damaging Het
Gm17334 A G 11: 53,663,654 (GRCm39) probably benign Het
Gpbp1 A T 13: 111,589,941 (GRCm39) D51E probably benign Het
Il12rb2 C G 6: 67,337,536 (GRCm39) C115S probably damaging Het
Il1rl1 T C 1: 40,501,204 (GRCm39) S527P probably damaging Het
Ireb2 A G 9: 54,788,733 (GRCm39) D69G probably benign Het
Kif5a T C 10: 127,081,238 (GRCm39) D232G probably damaging Het
M1ap A G 6: 82,958,863 (GRCm39) I165V probably benign Het
Mff T A 1: 82,729,421 (GRCm39) L287H probably damaging Het
Mmp27 A G 9: 7,577,740 (GRCm39) M311V possibly damaging Het
Mpped2 T A 2: 106,575,147 (GRCm39) Y77* probably null Het
Mybbp1a G A 11: 72,332,271 (GRCm39) S21N probably benign Het
Obscn G C 11: 58,960,107 (GRCm39) I3253M probably damaging Het
Obscn T C 11: 59,023,478 (GRCm39) D633G probably damaging Het
Olr1 C T 6: 129,479,057 (GRCm39) V54I probably benign Het
Or10j3b A T 1: 173,043,377 (GRCm39) D53V probably damaging Het
Or4a74 A G 2: 89,439,822 (GRCm39) V208A probably benign Het
Phlpp2 T C 8: 110,655,124 (GRCm39) S605P possibly damaging Het
Plekhg4 TAGTCGATGCCCGAGTC TAGTC 8: 106,103,084 (GRCm39) probably benign Het
Potefam1 T C 2: 111,030,763 (GRCm39) E382G probably damaging Het
Prss8 C A 7: 127,526,266 (GRCm39) R148L possibly damaging Het
Psg27 T C 7: 18,294,342 (GRCm39) D355G probably damaging Het
Rabgef1 C A 5: 130,216,402 (GRCm39) Q52K probably benign Het
Rnf6 C T 5: 146,147,716 (GRCm39) R434H probably damaging Het
Rpl26 A G 11: 68,794,099 (GRCm39) E88G probably benign Het
Rpn1 T A 6: 88,077,944 (GRCm39) L460Q probably damaging Het
Sap130 T A 18: 31,781,332 (GRCm39) I165N probably damaging Het
Sash1 A G 10: 8,632,461 (GRCm39) V258A probably damaging Het
Scarb1 G T 5: 125,371,207 (GRCm39) N288K probably benign Het
Sec16a A G 2: 26,330,251 (GRCm39) I588T probably damaging Het
Shank2 C A 7: 143,963,277 (GRCm39) S295Y probably damaging Het
Slc15a3 T C 19: 10,834,663 (GRCm39) S515P probably damaging Het
Slc25a13 A T 6: 6,114,017 (GRCm39) M285K probably benign Het
Slc39a11 A G 11: 113,354,800 (GRCm39) I143T probably null Het
Smarcd2 A T 11: 106,156,133 (GRCm39) L42* probably null Het
Smc3 A G 19: 53,619,964 (GRCm39) D620G probably benign Het
Spata31g1 A T 4: 42,974,171 (GRCm39) D1168V probably benign Het
Syt10 C T 15: 89,674,979 (GRCm39) D456N probably damaging Het
Taar4 A C 10: 23,837,071 (GRCm39) Q227P probably benign Het
Tasor T A 14: 27,183,170 (GRCm39) I543K probably benign Het
Tecta G T 9: 42,248,575 (GRCm39) Y1937* probably null Het
Tex10 C T 4: 48,456,800 (GRCm39) R637Q probably benign Het
Tmem130 T A 5: 144,692,084 (GRCm39) T107S possibly damaging Het
Tmem132d T C 5: 128,346,195 (GRCm39) D109G probably damaging Het
Tmem81 A G 1: 132,435,644 (GRCm39) Y150C probably damaging Het
Tnrc18 C T 5: 142,745,461 (GRCm39) probably null Het
Trim43a A G 9: 88,468,147 (GRCm39) K256R possibly damaging Het
Trpm6 A G 19: 18,855,103 (GRCm39) T1921A probably damaging Het
Tubb3 C T 8: 124,148,009 (GRCm39) A314V probably damaging Het
Unc80 G A 1: 66,718,903 (GRCm39) probably null Het
Upb1 A G 10: 75,260,347 (GRCm39) T134A probably damaging Het
Vmn2r15 A T 5: 109,434,619 (GRCm39) M695K possibly damaging Het
Wwc1 G T 11: 35,780,180 (GRCm39) D258E possibly damaging Het
Zfp619 T A 7: 39,184,185 (GRCm39) Y72N probably benign Het
Zfp672 G T 11: 58,207,462 (GRCm39) H286Q possibly damaging Het
Other mutations in Ube3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00754:Ube3b APN 5 114,553,348 (GRCm39) missense possibly damaging 0.93
IGL01154:Ube3b APN 5 114,544,313 (GRCm39) missense probably null 0.86
IGL02632:Ube3b APN 5 114,536,902 (GRCm39) missense probably benign
IGL02850:Ube3b APN 5 114,544,310 (GRCm39) missense probably damaging 1.00
IGL02878:Ube3b APN 5 114,542,778 (GRCm39) splice site probably null
IGL02881:Ube3b APN 5 114,550,945 (GRCm39) missense possibly damaging 0.78
R0003:Ube3b UTSW 5 114,536,912 (GRCm39) missense probably benign 0.17
R0071:Ube3b UTSW 5 114,557,558 (GRCm39) missense probably damaging 1.00
R0071:Ube3b UTSW 5 114,557,558 (GRCm39) missense probably damaging 1.00
R0076:Ube3b UTSW 5 114,546,278 (GRCm39) critical splice donor site probably null
R0076:Ube3b UTSW 5 114,546,278 (GRCm39) critical splice donor site probably null
R0111:Ube3b UTSW 5 114,528,437 (GRCm39) splice site probably benign
R0309:Ube3b UTSW 5 114,557,530 (GRCm39) splice site probably benign
R0718:Ube3b UTSW 5 114,540,616 (GRCm39) nonsense probably null
R1344:Ube3b UTSW 5 114,556,636 (GRCm39) missense probably damaging 1.00
R1350:Ube3b UTSW 5 114,544,198 (GRCm39) splice site probably null
R1418:Ube3b UTSW 5 114,556,636 (GRCm39) missense probably damaging 1.00
R1732:Ube3b UTSW 5 114,525,506 (GRCm39) missense probably benign 0.01
R1764:Ube3b UTSW 5 114,542,678 (GRCm39) missense possibly damaging 0.89
R1975:Ube3b UTSW 5 114,537,926 (GRCm39) missense possibly damaging 0.80
R2014:Ube3b UTSW 5 114,549,210 (GRCm39) missense probably damaging 1.00
R2015:Ube3b UTSW 5 114,549,210 (GRCm39) missense probably damaging 1.00
R2041:Ube3b UTSW 5 114,525,294 (GRCm39) missense probably damaging 0.99
R2202:Ube3b UTSW 5 114,527,135 (GRCm39) missense probably damaging 1.00
R2205:Ube3b UTSW 5 114,527,135 (GRCm39) missense probably damaging 1.00
R3826:Ube3b UTSW 5 114,538,012 (GRCm39) missense probably damaging 0.99
R3829:Ube3b UTSW 5 114,538,012 (GRCm39) missense probably damaging 0.99
R3830:Ube3b UTSW 5 114,538,012 (GRCm39) missense probably damaging 0.99
R3927:Ube3b UTSW 5 114,553,741 (GRCm39) missense probably benign 0.03
R3974:Ube3b UTSW 5 114,550,491 (GRCm39) missense probably benign 0.05
R4049:Ube3b UTSW 5 114,550,931 (GRCm39) missense probably benign 0.09
R4096:Ube3b UTSW 5 114,531,147 (GRCm39) missense possibly damaging 0.65
R4261:Ube3b UTSW 5 114,536,489 (GRCm39) missense possibly damaging 0.80
R4415:Ube3b UTSW 5 114,550,505 (GRCm39) missense probably damaging 1.00
R4688:Ube3b UTSW 5 114,531,139 (GRCm39) missense probably benign 0.03
R4779:Ube3b UTSW 5 114,542,778 (GRCm39) splice site probably null
R4824:Ube3b UTSW 5 114,553,787 (GRCm39) splice site probably null
R4868:Ube3b UTSW 5 114,536,488 (GRCm39) missense probably benign 0.00
R4953:Ube3b UTSW 5 114,539,471 (GRCm39) missense probably benign 0.01
R5013:Ube3b UTSW 5 114,545,702 (GRCm39) missense probably damaging 1.00
R5057:Ube3b UTSW 5 114,544,318 (GRCm39) missense probably benign 0.01
R5117:Ube3b UTSW 5 114,557,692 (GRCm39) missense probably damaging 0.96
R5131:Ube3b UTSW 5 114,545,607 (GRCm39) missense probably damaging 1.00
R5498:Ube3b UTSW 5 114,556,635 (GRCm39) missense probably damaging 1.00
R5564:Ube3b UTSW 5 114,527,136 (GRCm39) missense probably damaging 1.00
R5572:Ube3b UTSW 5 114,544,240 (GRCm39) missense probably damaging 0.99
R5580:Ube3b UTSW 5 114,553,384 (GRCm39) missense probably benign
R5596:Ube3b UTSW 5 114,544,221 (GRCm39) splice site probably null
R5843:Ube3b UTSW 5 114,550,360 (GRCm39) missense probably damaging 1.00
R5910:Ube3b UTSW 5 114,553,370 (GRCm39) missense possibly damaging 0.63
R6591:Ube3b UTSW 5 114,546,185 (GRCm39) missense probably benign 0.00
R6691:Ube3b UTSW 5 114,546,185 (GRCm39) missense probably benign 0.00
R7148:Ube3b UTSW 5 114,544,313 (GRCm39) missense probably damaging 0.97
R7334:Ube3b UTSW 5 114,553,742 (GRCm39) missense possibly damaging 0.64
R7438:Ube3b UTSW 5 114,556,687 (GRCm39) missense probably damaging 1.00
R7438:Ube3b UTSW 5 114,553,345 (GRCm39) missense possibly damaging 0.79
R7640:Ube3b UTSW 5 114,553,384 (GRCm39) missense probably benign
R7825:Ube3b UTSW 5 114,539,373 (GRCm39) missense probably damaging 1.00
R7958:Ube3b UTSW 5 114,539,484 (GRCm39) missense probably benign 0.05
R8025:Ube3b UTSW 5 114,546,270 (GRCm39) missense probably damaging 0.99
R8058:Ube3b UTSW 5 114,544,846 (GRCm39) missense possibly damaging 0.58
R8087:Ube3b UTSW 5 114,550,550 (GRCm39) critical splice donor site probably null
R8182:Ube3b UTSW 5 114,530,199 (GRCm39) missense possibly damaging 0.77
R8322:Ube3b UTSW 5 114,540,747 (GRCm39) missense probably benign 0.04
R8465:Ube3b UTSW 5 114,528,451 (GRCm39) missense probably damaging 1.00
R8682:Ube3b UTSW 5 114,550,351 (GRCm39) missense probably damaging 1.00
R8708:Ube3b UTSW 5 114,531,151 (GRCm39) missense probably benign 0.34
R8758:Ube3b UTSW 5 114,553,261 (GRCm39) critical splice acceptor site probably benign
R8784:Ube3b UTSW 5 114,526,800 (GRCm39) missense probably damaging 1.00
R9058:Ube3b UTSW 5 114,553,300 (GRCm39) missense probably benign 0.05
R9072:Ube3b UTSW 5 114,542,607 (GRCm39) missense probably damaging 0.98
R9116:Ube3b UTSW 5 114,542,837 (GRCm39) intron probably benign
R9537:Ube3b UTSW 5 114,525,245 (GRCm39) missense probably damaging 1.00
R9596:Ube3b UTSW 5 114,527,171 (GRCm39) missense probably damaging 1.00
R9632:Ube3b UTSW 5 114,553,370 (GRCm39) missense probably benign 0.00
R9710:Ube3b UTSW 5 114,553,370 (GRCm39) missense probably benign 0.00
X0017:Ube3b UTSW 5 114,553,646 (GRCm39) missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- TTGGAGATGGTTCGAGAGCAC -3'
(R):5'- GAGTCACTCTATGTCAGAACCC -3'

Sequencing Primer
(F):5'- TGGTTCGAGAGCACTAGGC -3'
(R):5'- CTCTATGTCAGAACCCAAGGAGG -3'
Posted On 2014-09-17