Incidental Mutation 'R2074:Dnah10'
ID227411
Institutional Source Beutler Lab
Gene Symbol Dnah10
Ensembl Gene ENSMUSG00000038011
Gene Namedynein, axonemal, heavy chain 10
SynonymsDnahc10
MMRRC Submission 040079-MU
Accession Numbers

Ncbi RefSeq: NM_019536.1; MGI:1860299

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2074 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location124725085-124834308 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 124814674 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 3259 (S3259P)
Ref Sequence ENSEMBL: ENSMUSP00000114593 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058440] [ENSMUST00000141137]
Predicted Effect probably damaging
Transcript: ENSMUST00000058440
AA Change: S3316P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000062995
Gene: ENSMUSG00000038011
AA Change: S3316P

DomainStartEndE-ValueType
low complexity region 63 72 N/A INTRINSIC
low complexity region 80 86 N/A INTRINSIC
coiled coil region 260 282 N/A INTRINSIC
Pfam:DHC_N1 305 878 9.1e-154 PFAM
coiled coil region 1191 1218 N/A INTRINSIC
coiled coil region 1337 1360 N/A INTRINSIC
Pfam:DHC_N2 1374 1782 1.7e-142 PFAM
AAA 1946 2082 2.51e-1 SMART
AAA 2225 2373 6.91e-1 SMART
low complexity region 2444 2464 N/A INTRINSIC
AAA 2567 2720 2.29e-2 SMART
Pfam:AAA_8 2886 3153 9.8e-87 PFAM
Pfam:MT 3165 3502 9.1e-53 PFAM
Pfam:AAA_9 3522 3747 2.3e-90 PFAM
Pfam:Dynein_heavy 3884 4588 7.6e-240 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000141137
AA Change: S3259P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114593
Gene: ENSMUSG00000038011
AA Change: S3259P

DomainStartEndE-ValueType
low complexity region 63 72 N/A INTRINSIC
low complexity region 80 86 N/A INTRINSIC
coiled coil region 260 282 N/A INTRINSIC
Pfam:DHC_N1 304 607 4.3e-57 PFAM
Pfam:DHC_N1 598 823 1.2e-39 PFAM
coiled coil region 1134 1161 N/A INTRINSIC
coiled coil region 1280 1303 N/A INTRINSIC
Pfam:DHC_N2 1315 1727 7.3e-135 PFAM
AAA 1889 2025 4e-3 SMART
AAA 2168 2316 1.1e-2 SMART
low complexity region 2387 2407 N/A INTRINSIC
AAA 2510 2663 3.6e-4 SMART
Pfam:AAA_8 2829 3096 2.5e-83 PFAM
Pfam:MT 3108 3445 1.2e-50 PFAM
Pfam:AAA_9 3461 3691 6.7e-59 PFAM
Pfam:Dynein_heavy 3821 4532 1.9e-231 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196708
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197269
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. The axonemal dyneins, found in cilia and flagella, are components of the outer and inner dynein arms attached to the peripheral microtubule doublets. DNAH10 is an inner arm dynein heavy chain (Maiti et al., 2000 [PubMed 11175280]).[supplied by OMIM, Mar 2008]
Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A T 4: 42,974,171 D1168V probably benign Het
4930430A15Rik T C 2: 111,200,418 E382G probably damaging Het
9130011E15Rik A T 19: 45,965,381 I188K probably damaging Het
Ace C T 11: 105,976,623 Q484* probably null Het
Ackr3 T C 1: 90,213,981 I54T probably damaging Het
Aco1 G A 4: 40,183,605 G508S probably damaging Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Ankef1 T C 2: 136,545,738 S192P possibly damaging Het
Ankrd16 T G 2: 11,789,748 C315G possibly damaging Het
Ankzf1 T C 1: 75,196,243 S328P probably damaging Het
Aqp2 A G 15: 99,583,100 I176V probably benign Het
Arhgap45 A G 10: 80,027,180 Y730C probably damaging Het
Asxl2 A G 12: 3,493,779 E316G probably damaging Het
Btbd17 A T 11: 114,791,952 probably null Het
Calu A G 6: 29,372,615 Y263C probably damaging Het
Ccdc122 T C 14: 77,068,951 probably null Het
Cenpf T C 1: 189,656,901 K1578R probably damaging Het
Cep120 A G 18: 53,719,312 V498A possibly damaging Het
Ces1a T A 8: 93,048,075 N12Y probably benign Het
Chmp1a A T 8: 123,208,022 M65K probably damaging Het
Cnot1 G T 8: 95,739,833 T1592K possibly damaging Het
Cps1 T A 1: 67,204,638 I1091N probably benign Het
Dhx32 T C 7: 133,721,292 N731S probably benign Het
Dhx33 G A 11: 70,999,843 R177W probably damaging Het
Dmd G C X: 84,312,483 A2257P probably benign Het
Dnah7a T C 1: 53,457,696 I3134V probably benign Het
Dock3 A G 9: 106,993,463 F584S possibly damaging Het
Dtnb A G 12: 3,781,273 T658A probably benign Het
Duox2 T A 2: 122,295,158 S323C probably damaging Het
Elovl3 A T 19: 46,132,167 E33V probably damaging Het
Enpp5 T C 17: 44,085,373 F392S probably benign Het
Eogt T C 6: 97,131,376 T235A probably benign Het
Etv3 T C 3: 87,536,219 V370A probably benign Het
Ewsr1 C T 11: 5,071,555 R466H unknown Het
Fam208a T A 14: 27,461,213 I543K probably benign Het
Fcgbp G A 7: 28,120,389 G2514S probably damaging Het
Flt1 A T 5: 147,599,606 D808E possibly damaging Het
Glg1 C T 8: 111,168,671 G836E probably damaging Het
Gm17334 A G 11: 53,772,828 probably benign Het
Gpbp1 A T 13: 111,453,407 D51E probably benign Het
Il12rb2 C G 6: 67,360,552 C115S probably damaging Het
Il1rl1 T C 1: 40,462,044 S527P probably damaging Het
Ireb2 A G 9: 54,881,449 D69G probably benign Het
Kif5a T C 10: 127,245,369 D232G probably damaging Het
M1ap A G 6: 82,981,882 I165V probably benign Het
Mff T A 1: 82,751,700 L287H probably damaging Het
Mmp27 A G 9: 7,577,739 M311V possibly damaging Het
Mpped2 T A 2: 106,744,802 Y77* probably null Het
Mybbp1a G A 11: 72,441,445 S21N probably benign Het
Obscn G C 11: 59,069,281 I3253M probably damaging Het
Obscn T C 11: 59,132,652 D633G probably damaging Het
Olfr1247 A G 2: 89,609,478 V208A probably benign Het
Olfr1404 A T 1: 173,215,810 D53V probably damaging Het
Olr1 C T 6: 129,502,094 V54I probably benign Het
Phlpp2 T C 8: 109,928,492 S605P possibly damaging Het
Plekhg4 TAGTCGATGCCCGAGTC TAGTC 8: 105,376,452 probably benign Het
Prss8 C A 7: 127,927,094 R148L possibly damaging Het
Psg27 T C 7: 18,560,417 D355G probably damaging Het
Rabgef1 C A 5: 130,187,561 Q52K probably benign Het
Rnf6 C T 5: 146,210,906 R434H probably damaging Het
Rpl26 A G 11: 68,903,273 E88G probably benign Het
Rpn1 T A 6: 88,100,962 L460Q probably damaging Het
Sap130 T A 18: 31,648,279 I165N probably damaging Het
Sash1 A G 10: 8,756,697 V258A probably damaging Het
Scarb1 G T 5: 125,294,143 N288K probably benign Het
Sec16a A G 2: 26,440,239 I588T probably damaging Het
Shank2 C A 7: 144,409,540 S295Y probably damaging Het
Slc15a3 T C 19: 10,857,299 S515P probably damaging Het
Slc25a13 A T 6: 6,114,017 M285K probably benign Het
Slc39a11 A G 11: 113,463,974 I143T probably null Het
Smarcd2 A T 11: 106,265,307 L42* probably null Het
Smc3 A G 19: 53,631,533 D620G probably benign Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Taar4 A C 10: 23,961,173 Q227P probably benign Het
Tecta G T 9: 42,337,279 Y1937* probably null Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tmem130 T A 5: 144,755,274 T107S possibly damaging Het
Tmem132d T C 5: 128,269,131 D109G probably damaging Het
Tmem81 A G 1: 132,507,906 Y150C probably damaging Het
Tnrc18 C T 5: 142,759,706 probably null Het
Trim43a A G 9: 88,586,094 K256R possibly damaging Het
Trpm6 A G 19: 18,877,739 T1921A probably damaging Het
Tubb3 C T 8: 123,421,270 A314V probably damaging Het
Ube3b A C 5: 114,415,255 N896T probably benign Het
Unc80 G A 1: 66,679,744 probably null Het
Upb1 A G 10: 75,424,513 T134A probably damaging Het
Vmn2r15 A T 5: 109,286,753 M695K possibly damaging Het
Wwc1 G T 11: 35,889,353 D258E possibly damaging Het
Zfp619 T A 7: 39,534,761 Y72N probably benign Het
Zfp672 G T 11: 58,316,636 H286Q possibly damaging Het
Other mutations in Dnah10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Dnah10 APN 5 124828603 missense probably damaging 1.00
IGL00089:Dnah10 APN 5 124746616 missense probably benign 0.01
IGL00471:Dnah10 APN 5 124794341 missense probably damaging 1.00
IGL01336:Dnah10 APN 5 124775512 missense probably damaging 1.00
IGL01339:Dnah10 APN 5 124777212 missense probably damaging 1.00
IGL01372:Dnah10 APN 5 124779154 missense probably damaging 1.00
IGL01572:Dnah10 APN 5 124783946 missense probably damaging 1.00
IGL01634:Dnah10 APN 5 124821341 missense probably damaging 0.98
IGL01649:Dnah10 APN 5 124732489 missense probably damaging 0.97
IGL01676:Dnah10 APN 5 124803328 missense possibly damaging 0.65
IGL01729:Dnah10 APN 5 124787465 missense probably benign 0.10
IGL01757:Dnah10 APN 5 124768927 missense probably benign 0.37
IGL01759:Dnah10 APN 5 124755786 missense probably benign
IGL01767:Dnah10 APN 5 124743737 splice site probably benign
IGL01769:Dnah10 APN 5 124764944 missense possibly damaging 0.63
IGL01805:Dnah10 APN 5 124783921 missense probably damaging 1.00
IGL02090:Dnah10 APN 5 124789812 missense probably damaging 1.00
IGL02162:Dnah10 APN 5 124804746 missense probably damaging 1.00
IGL02312:Dnah10 APN 5 124819366 missense probably damaging 1.00
IGL02347:Dnah10 APN 5 124833423 critical splice acceptor site probably null
IGL02378:Dnah10 APN 5 124773067 missense probably damaging 1.00
IGL02440:Dnah10 APN 5 124773819 missense probably damaging 1.00
IGL02457:Dnah10 APN 5 124789796 missense probably damaging 1.00
IGL02487:Dnah10 APN 5 124793852 missense possibly damaging 0.90
IGL02502:Dnah10 APN 5 124821287 missense probably damaging 1.00
IGL02516:Dnah10 APN 5 124787331 missense probably damaging 1.00
IGL02544:Dnah10 APN 5 124799005 missense probably benign 0.26
IGL02709:Dnah10 APN 5 124773745 nonsense probably null
IGL02740:Dnah10 APN 5 124826863 splice site probably benign
IGL02746:Dnah10 APN 5 124730086 missense possibly damaging 0.55
IGL02803:Dnah10 APN 5 124798014 missense probably damaging 0.99
IGL02900:Dnah10 APN 5 124801822 missense probably damaging 1.00
IGL02957:Dnah10 APN 5 124763133 missense probably benign 0.07
IGL03076:Dnah10 APN 5 124730162 critical splice donor site probably null
IGL03109:Dnah10 APN 5 124764886 missense probably benign 0.10
IGL03181:Dnah10 APN 5 124748457 missense probably damaging 0.99
IGL03185:Dnah10 APN 5 124817643 missense probably damaging 1.00
IGL03199:Dnah10 APN 5 124817697 missense probably benign 0.00
IGL03328:Dnah10 APN 5 124754290 missense probably benign 0.06
frosty UTSW 5 124828137 missense probably damaging 1.00
H8562:Dnah10 UTSW 5 124829529 missense probably damaging 1.00
I2288:Dnah10 UTSW 5 124730100 missense probably benign
P0019:Dnah10 UTSW 5 124763066 missense probably benign
P0037:Dnah10 UTSW 5 124817992 nonsense probably null
PIT4366001:Dnah10 UTSW 5 124775524 missense possibly damaging 0.95
R0004:Dnah10 UTSW 5 124726902 missense probably benign
R0032:Dnah10 UTSW 5 124800891 missense possibly damaging 0.94
R0032:Dnah10 UTSW 5 124800891 missense possibly damaging 0.94
R0050:Dnah10 UTSW 5 124830744 missense probably benign 0.00
R0066:Dnah10 UTSW 5 124763076 missense probably benign 0.01
R0164:Dnah10 UTSW 5 124783834 missense probably damaging 1.00
R0164:Dnah10 UTSW 5 124783834 missense probably damaging 1.00
R0196:Dnah10 UTSW 5 124834075 missense possibly damaging 0.80
R0312:Dnah10 UTSW 5 124796369 splice site probably benign
R0321:Dnah10 UTSW 5 124823352 missense probably benign 0.29
R0410:Dnah10 UTSW 5 124755735 missense probably benign
R0480:Dnah10 UTSW 5 124808851 missense probably damaging 1.00
R0531:Dnah10 UTSW 5 124812723 critical splice donor site probably null
R0533:Dnah10 UTSW 5 124775250 splice site probably null
R0599:Dnah10 UTSW 5 124800953 missense probably damaging 1.00
R0686:Dnah10 UTSW 5 124747718 missense possibly damaging 0.95
R0688:Dnah10 UTSW 5 124747718 missense possibly damaging 0.95
R0780:Dnah10 UTSW 5 124750812 missense possibly damaging 0.87
R0968:Dnah10 UTSW 5 124829577 missense probably damaging 0.99
R0989:Dnah10 UTSW 5 124797938 missense probably benign 0.00
R1203:Dnah10 UTSW 5 124760014 splice site probably null
R1248:Dnah10 UTSW 5 124755823 splice site probably benign
R1366:Dnah10 UTSW 5 124753326 missense probably benign 0.41
R1434:Dnah10 UTSW 5 124774986 missense probably benign 0.03
R1436:Dnah10 UTSW 5 124762221 missense probably benign 0.00
R1438:Dnah10 UTSW 5 124798945 missense probably benign 0.25
R1446:Dnah10 UTSW 5 124789796 missense probably damaging 1.00
R1459:Dnah10 UTSW 5 124743686 missense possibly damaging 0.90
R1466:Dnah10 UTSW 5 124763096 missense probably benign
R1466:Dnah10 UTSW 5 124763096 missense probably benign
R1479:Dnah10 UTSW 5 124777889 missense possibly damaging 0.71
R1505:Dnah10 UTSW 5 124754239 missense possibly damaging 0.82
R1519:Dnah10 UTSW 5 124760952 missense probably damaging 0.98
R1565:Dnah10 UTSW 5 124829614 missense probably damaging 1.00
R1668:Dnah10 UTSW 5 124765562 missense probably benign 0.00
R1709:Dnah10 UTSW 5 124760091 missense probably damaging 0.99
R1740:Dnah10 UTSW 5 124773190 intron probably null
R1828:Dnah10 UTSW 5 124761279 missense probably benign 0.00
R1854:Dnah10 UTSW 5 124804689 missense probably damaging 0.99
R1865:Dnah10 UTSW 5 124832526 unclassified probably null
R1893:Dnah10 UTSW 5 124754317 missense probably benign 0.13
R1895:Dnah10 UTSW 5 124758430 missense probably benign 0.00
R1906:Dnah10 UTSW 5 124800984 missense probably damaging 1.00
R1953:Dnah10 UTSW 5 124782268 missense probably benign 0.00
R1965:Dnah10 UTSW 5 124775203 missense probably damaging 1.00
R2002:Dnah10 UTSW 5 124833988 missense probably damaging 1.00
R2006:Dnah10 UTSW 5 124829587 missense possibly damaging 0.58
R2037:Dnah10 UTSW 5 124746704 missense probably benign 0.30
R2046:Dnah10 UTSW 5 124796341 missense probably benign 0.25
R2081:Dnah10 UTSW 5 124774981 missense possibly damaging 0.88
R2257:Dnah10 UTSW 5 124761237 missense probably damaging 1.00
R2272:Dnah10 UTSW 5 124731466 missense probably benign 0.00
R2293:Dnah10 UTSW 5 124819221 missense probably damaging 0.97
R2323:Dnah10 UTSW 5 124742000 missense probably damaging 1.00
R2435:Dnah10 UTSW 5 124762865 critical splice donor site probably null
R2571:Dnah10 UTSW 5 124775478 missense probably damaging 1.00
R2898:Dnah10 UTSW 5 124817670 missense probably damaging 1.00
R2937:Dnah10 UTSW 5 124819412 critical splice donor site probably null
R3439:Dnah10 UTSW 5 124796258 missense possibly damaging 0.91
R3548:Dnah10 UTSW 5 124747630 missense possibly damaging 0.50
R3881:Dnah10 UTSW 5 124773031 missense probably benign 0.37
R4015:Dnah10 UTSW 5 124777926 missense probably benign 0.25
R4261:Dnah10 UTSW 5 124730137 missense possibly damaging 0.95
R4277:Dnah10 UTSW 5 124732330 missense probably benign 0.28
R4299:Dnah10 UTSW 5 124819925 missense probably damaging 1.00
R4613:Dnah10 UTSW 5 124762869 splice site probably null
R4651:Dnah10 UTSW 5 124729143 missense probably benign 0.20
R4652:Dnah10 UTSW 5 124729143 missense probably benign 0.20
R4664:Dnah10 UTSW 5 124828472 missense possibly damaging 0.95
R4665:Dnah10 UTSW 5 124828472 missense possibly damaging 0.95
R4666:Dnah10 UTSW 5 124828472 missense possibly damaging 0.95
R4691:Dnah10 UTSW 5 124775517 missense probably damaging 1.00
R4755:Dnah10 UTSW 5 124747745 missense probably benign 0.01
R4806:Dnah10 UTSW 5 124819344 missense probably damaging 1.00
R4839:Dnah10 UTSW 5 124773132 missense probably damaging 1.00
R4903:Dnah10 UTSW 5 124817748 missense probably damaging 1.00
R5018:Dnah10 UTSW 5 124762196 missense possibly damaging 0.79
R5101:Dnah10 UTSW 5 124832513 missense possibly damaging 0.51
R5105:Dnah10 UTSW 5 124811482 missense probably benign 0.01
R5119:Dnah10 UTSW 5 124779258 missense probably damaging 1.00
R5139:Dnah10 UTSW 5 124798960 missense probably damaging 0.99
R5242:Dnah10 UTSW 5 124787420 missense probably benign 0.00
R5262:Dnah10 UTSW 5 124785156 missense probably damaging 1.00
R5277:Dnah10 UTSW 5 124828137 missense probably damaging 1.00
R5293:Dnah10 UTSW 5 124791787 missense probably benign 0.01
R5322:Dnah10 UTSW 5 124773566 missense probably damaging 1.00
R5371:Dnah10 UTSW 5 124743629 missense probably benign 0.16
R5468:Dnah10 UTSW 5 124830493 missense probably damaging 1.00
R5470:Dnah10 UTSW 5 124753168 missense probably benign
R5587:Dnah10 UTSW 5 124793913 missense probably benign 0.10
R5724:Dnah10 UTSW 5 124742026 missense probably benign 0.27
R5797:Dnah10 UTSW 5 124821386 missense probably benign 0.00
R5812:Dnah10 UTSW 5 124747746 missense probably benign 0.01
R5846:Dnah10 UTSW 5 124823373 missense possibly damaging 0.80
R5930:Dnah10 UTSW 5 124791791 critical splice donor site probably null
R5961:Dnah10 UTSW 5 124811482 missense probably benign 0.01
R5970:Dnah10 UTSW 5 124808729 missense probably benign
R6021:Dnah10 UTSW 5 124736984 missense probably damaging 1.00
R6043:Dnah10 UTSW 5 124801860 missense probably damaging 1.00
R6073:Dnah10 UTSW 5 124819210 missense probably benign 0.09
R6080:Dnah10 UTSW 5 124805897 missense possibly damaging 0.71
R6093:Dnah10 UTSW 5 124753174 missense probably benign 0.18
R6155:Dnah10 UTSW 5 124770599 missense probably damaging 1.00
R6155:Dnah10 UTSW 5 124785175 missense probably damaging 1.00
R6162:Dnah10 UTSW 5 124823318 missense probably benign 0.02
R6238:Dnah10 UTSW 5 124743679 missense probably damaging 0.97
R6248:Dnah10 UTSW 5 124794219 splice site probably null
R6275:Dnah10 UTSW 5 124785184 missense probably damaging 1.00
R6297:Dnah10 UTSW 5 124775080 missense possibly damaging 0.55
R6388:Dnah10 UTSW 5 124829646 missense probably benign 0.00
R6458:Dnah10 UTSW 5 124809269 missense probably damaging 1.00
R6504:Dnah10 UTSW 5 124762782 missense possibly damaging 0.50
R6518:Dnah10 UTSW 5 124758355 missense probably damaging 0.99
R6627:Dnah10 UTSW 5 124830033 missense probably damaging 1.00
R6701:Dnah10 UTSW 5 124760159 missense probably benign 0.45
R6702:Dnah10 UTSW 5 124805805 missense probably damaging 1.00
R6745:Dnah10 UTSW 5 124808812 missense probably damaging 1.00
R6784:Dnah10 UTSW 5 124777826 missense probably damaging 0.99
R6807:Dnah10 UTSW 5 124790000 intron probably null
R6932:Dnah10 UTSW 5 124821450 missense possibly damaging 0.75
R7007:Dnah10 UTSW 5 124787426 missense probably damaging 1.00
R7091:Dnah10 UTSW 5 124816142 missense probably benign 0.37
R7138:Dnah10 UTSW 5 124822945 missense probably damaging 1.00
R7144:Dnah10 UTSW 5 124822942 missense probably damaging 0.98
R7231:Dnah10 UTSW 5 124813828 missense probably benign 0.19
R7278:Dnah10 UTSW 5 124791791 critical splice donor site probably null
R7284:Dnah10 UTSW 5 124832598 missense probably benign 0.37
R7322:Dnah10 UTSW 5 124821269 missense probably benign 0.08
R7523:Dnah10 UTSW 5 124747739 missense probably damaging 0.97
R7565:Dnah10 UTSW 5 124799031 missense probably damaging 1.00
R7593:Dnah10 UTSW 5 124746544 missense probably benign 0.21
R7606:Dnah10 UTSW 5 124817712 missense probably benign 0.00
R7835:Dnah10 UTSW 5 124777234 missense probably damaging 1.00
R7898:Dnah10 UTSW 5 124782361 missense probably damaging 1.00
R7918:Dnah10 UTSW 5 124777234 missense probably damaging 1.00
R7981:Dnah10 UTSW 5 124782361 missense probably damaging 1.00
R7999:Dnah10 UTSW 5 124725258 missense probably benign 0.06
R8032:Dnah10 UTSW 5 124746612 missense probably damaging 0.98
R8052:Dnah10 UTSW 5 124828511 missense probably benign 0.00
RF015:Dnah10 UTSW 5 124818077 missense probably damaging 1.00
RF021:Dnah10 UTSW 5 124777907 missense probably damaging 1.00
T0975:Dnah10 UTSW 5 124763066 missense probably benign
U24488:Dnah10 UTSW 5 124813980 missense probably damaging 1.00
X0017:Dnah10 UTSW 5 124765697 missense probably benign 0.22
Z1176:Dnah10 UTSW 5 124775355 missense probably benign 0.11
Z1177:Dnah10 UTSW 5 124741955 missense probably damaging 1.00
Z1177:Dnah10 UTSW 5 124747619 missense possibly damaging 0.64
Z1177:Dnah10 UTSW 5 124817988 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ATTCTGGCTAGGTCCTGGTCTC -3'
(R):5'- TTTCTCTGCCACTGAGAGCC -3'

Sequencing Primer
(F):5'- TGGTCTCTCTGAACACGGG -3'
(R):5'- ACCCTCTGCTGAGCTGTGTATG -3'
Posted On2014-09-17