Incidental Mutation 'R2074:Flt1'
ID 227419
Institutional Source Beutler Lab
Gene Symbol Flt1
Ensembl Gene ENSMUSG00000029648
Gene Name FMS-like tyrosine kinase 1
Synonyms VEGFR-1, VEGFR1, vascular endothelial growth factor receptor-1, Flt-1, sFlt1
MMRRC Submission 040079-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2074 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 147498414-147662821 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 147536416 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 808 (D808E)
Ref Sequence ENSEMBL: ENSMUSP00000031653 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031653]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000031653
AA Change: D808E

PolyPhen 2 Score 0.818 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000031653
Gene: ENSMUSG00000029648
AA Change: D808E

DomainStartEndE-ValueType
IG 38 130 1.74e-3 SMART
IG 144 225 1.49e-2 SMART
IG 238 330 2.23e-10 SMART
IG 345 426 2.43e-2 SMART
IG 440 554 2.6e-2 SMART
IGc2 569 644 1.76e-8 SMART
IGc2 674 739 6.29e-19 SMART
low complexity region 769 786 N/A INTRINSIC
TyrKc 828 1154 9.54e-144 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the vascular endothelial growth factor receptor (VEGFR) family. VEGFR family members are receptor tyrosine kinases (RTKs) which contain an extracellular ligand-binding region with seven immunoglobulin (Ig)-like domains, a transmembrane segment, and a tyrosine kinase (TK) domain within the cytoplasmic domain. This protein binds to VEGFR-A, VEGFR-B and placental growth factor and plays an important role in angiogenesis and vasculogenesis. Expression of this receptor is found in vascular endothelial cells, placental trophoblast cells and peripheral blood monocytes. Multiple transcript variants encoding different isoforms have been found for this gene. Isoforms include a full-length transmembrane receptor isoform and shortened, soluble isoforms. The soluble isoforms are associated with the onset of pre-eclampsia.[provided by RefSeq, May 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit an excess of hemangioblasts resulting in an overgrowth of endothelial cells, abnormalities of vascular channels and blood islands, and lethality at the mid-somite developmental stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace C T 11: 105,867,449 (GRCm39) Q484* probably null Het
Ackr3 T C 1: 90,141,703 (GRCm39) I54T probably damaging Het
Aco1 G A 4: 40,183,605 (GRCm39) G508S probably damaging Het
Akap8l C T 17: 32,551,457 (GRCm39) R511H probably damaging Het
Ankef1 T C 2: 136,387,658 (GRCm39) S192P possibly damaging Het
Ankrd16 T G 2: 11,794,559 (GRCm39) C315G possibly damaging Het
Ankzf1 T C 1: 75,172,887 (GRCm39) S328P probably damaging Het
Aqp2 A G 15: 99,480,981 (GRCm39) I176V probably benign Het
Arhgap45 A G 10: 79,863,014 (GRCm39) Y730C probably damaging Het
Armh3 A T 19: 45,953,820 (GRCm39) I188K probably damaging Het
Asxl2 A G 12: 3,543,779 (GRCm39) E316G probably damaging Het
Btbd17 A T 11: 114,682,778 (GRCm39) probably null Het
Calu A G 6: 29,372,614 (GRCm39) Y263C probably damaging Het
Ccdc122 T C 14: 77,306,391 (GRCm39) probably null Het
Cenpf T C 1: 189,389,098 (GRCm39) K1578R probably damaging Het
Cep120 A G 18: 53,852,384 (GRCm39) V498A possibly damaging Het
Ces1a T A 8: 93,774,703 (GRCm39) N12Y probably benign Het
Chmp1a A T 8: 123,934,761 (GRCm39) M65K probably damaging Het
Cnot1 G T 8: 96,466,461 (GRCm39) T1592K possibly damaging Het
Cps1 T A 1: 67,243,797 (GRCm39) I1091N probably benign Het
Dhx32 T C 7: 133,323,021 (GRCm39) N731S probably benign Het
Dhx33 G A 11: 70,890,669 (GRCm39) R177W probably damaging Het
Dmd G C X: 83,356,089 (GRCm39) A2257P probably benign Het
Dnah10 T C 5: 124,891,738 (GRCm39) S3259P probably damaging Het
Dnah7a T C 1: 53,496,855 (GRCm39) I3134V probably benign Het
Dock3 A G 9: 106,870,662 (GRCm39) F584S possibly damaging Het
Dtnb A G 12: 3,831,273 (GRCm39) T658A probably benign Het
Duox2 T A 2: 122,125,639 (GRCm39) S323C probably damaging Het
Elovl3 A T 19: 46,120,606 (GRCm39) E33V probably damaging Het
Enpp5 T C 17: 44,396,264 (GRCm39) F392S probably benign Het
Eogt T C 6: 97,108,337 (GRCm39) T235A probably benign Het
Etv3 T C 3: 87,443,526 (GRCm39) V370A probably benign Het
Ewsr1 C T 11: 5,021,555 (GRCm39) R466H unknown Het
Fcgbp G A 7: 27,819,814 (GRCm39) G2514S probably damaging Het
Glg1 C T 8: 111,895,303 (GRCm39) G836E probably damaging Het
Gm17334 A G 11: 53,663,654 (GRCm39) probably benign Het
Gpbp1 A T 13: 111,589,941 (GRCm39) D51E probably benign Het
Il12rb2 C G 6: 67,337,536 (GRCm39) C115S probably damaging Het
Il1rl1 T C 1: 40,501,204 (GRCm39) S527P probably damaging Het
Ireb2 A G 9: 54,788,733 (GRCm39) D69G probably benign Het
Kif5a T C 10: 127,081,238 (GRCm39) D232G probably damaging Het
M1ap A G 6: 82,958,863 (GRCm39) I165V probably benign Het
Mff T A 1: 82,729,421 (GRCm39) L287H probably damaging Het
Mmp27 A G 9: 7,577,740 (GRCm39) M311V possibly damaging Het
Mpped2 T A 2: 106,575,147 (GRCm39) Y77* probably null Het
Mybbp1a G A 11: 72,332,271 (GRCm39) S21N probably benign Het
Obscn G C 11: 58,960,107 (GRCm39) I3253M probably damaging Het
Obscn T C 11: 59,023,478 (GRCm39) D633G probably damaging Het
Olr1 C T 6: 129,479,057 (GRCm39) V54I probably benign Het
Or10j3b A T 1: 173,043,377 (GRCm39) D53V probably damaging Het
Or4a74 A G 2: 89,439,822 (GRCm39) V208A probably benign Het
Phlpp2 T C 8: 110,655,124 (GRCm39) S605P possibly damaging Het
Plekhg4 TAGTCGATGCCCGAGTC TAGTC 8: 106,103,084 (GRCm39) probably benign Het
Potefam1 T C 2: 111,030,763 (GRCm39) E382G probably damaging Het
Prss8 C A 7: 127,526,266 (GRCm39) R148L possibly damaging Het
Psg27 T C 7: 18,294,342 (GRCm39) D355G probably damaging Het
Rabgef1 C A 5: 130,216,402 (GRCm39) Q52K probably benign Het
Rnf6 C T 5: 146,147,716 (GRCm39) R434H probably damaging Het
Rpl26 A G 11: 68,794,099 (GRCm39) E88G probably benign Het
Rpn1 T A 6: 88,077,944 (GRCm39) L460Q probably damaging Het
Sap130 T A 18: 31,781,332 (GRCm39) I165N probably damaging Het
Sash1 A G 10: 8,632,461 (GRCm39) V258A probably damaging Het
Scarb1 G T 5: 125,371,207 (GRCm39) N288K probably benign Het
Sec16a A G 2: 26,330,251 (GRCm39) I588T probably damaging Het
Shank2 C A 7: 143,963,277 (GRCm39) S295Y probably damaging Het
Slc15a3 T C 19: 10,834,663 (GRCm39) S515P probably damaging Het
Slc25a13 A T 6: 6,114,017 (GRCm39) M285K probably benign Het
Slc39a11 A G 11: 113,354,800 (GRCm39) I143T probably null Het
Smarcd2 A T 11: 106,156,133 (GRCm39) L42* probably null Het
Smc3 A G 19: 53,619,964 (GRCm39) D620G probably benign Het
Spata31g1 A T 4: 42,974,171 (GRCm39) D1168V probably benign Het
Syt10 C T 15: 89,674,979 (GRCm39) D456N probably damaging Het
Taar4 A C 10: 23,837,071 (GRCm39) Q227P probably benign Het
Tasor T A 14: 27,183,170 (GRCm39) I543K probably benign Het
Tecta G T 9: 42,248,575 (GRCm39) Y1937* probably null Het
Tex10 C T 4: 48,456,800 (GRCm39) R637Q probably benign Het
Tmem130 T A 5: 144,692,084 (GRCm39) T107S possibly damaging Het
Tmem132d T C 5: 128,346,195 (GRCm39) D109G probably damaging Het
Tmem81 A G 1: 132,435,644 (GRCm39) Y150C probably damaging Het
Tnrc18 C T 5: 142,745,461 (GRCm39) probably null Het
Trim43a A G 9: 88,468,147 (GRCm39) K256R possibly damaging Het
Trpm6 A G 19: 18,855,103 (GRCm39) T1921A probably damaging Het
Tubb3 C T 8: 124,148,009 (GRCm39) A314V probably damaging Het
Ube3b A C 5: 114,553,316 (GRCm39) N896T probably benign Het
Unc80 G A 1: 66,718,903 (GRCm39) probably null Het
Upb1 A G 10: 75,260,347 (GRCm39) T134A probably damaging Het
Vmn2r15 A T 5: 109,434,619 (GRCm39) M695K possibly damaging Het
Wwc1 G T 11: 35,780,180 (GRCm39) D258E possibly damaging Het
Zfp619 T A 7: 39,184,185 (GRCm39) Y72N probably benign Het
Zfp672 G T 11: 58,207,462 (GRCm39) H286Q possibly damaging Het
Other mutations in Flt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Flt1 APN 5 147,517,110 (GRCm39) critical splice donor site probably null
IGL00469:Flt1 APN 5 147,540,415 (GRCm39) missense probably damaging 0.99
IGL00897:Flt1 APN 5 147,526,664 (GRCm39) missense probably benign 0.25
IGL01111:Flt1 APN 5 147,515,146 (GRCm39) missense probably damaging 1.00
IGL01154:Flt1 APN 5 147,512,966 (GRCm39) missense possibly damaging 0.63
IGL01744:Flt1 APN 5 147,508,271 (GRCm39) missense probably benign 0.01
IGL01973:Flt1 APN 5 147,620,699 (GRCm39) missense probably benign 0.01
IGL02079:Flt1 APN 5 147,505,641 (GRCm39) splice site probably benign
IGL02143:Flt1 APN 5 147,515,246 (GRCm39) missense probably benign 0.00
IGL02156:Flt1 APN 5 147,618,551 (GRCm39) missense probably damaging 0.99
IGL02345:Flt1 APN 5 147,519,436 (GRCm39) missense probably benign 0.20
IGL02548:Flt1 APN 5 147,576,058 (GRCm39) missense probably benign 0.00
IGL02631:Flt1 APN 5 147,610,384 (GRCm39) nonsense probably null
IGL02686:Flt1 APN 5 147,525,412 (GRCm39) missense probably damaging 1.00
IGL02938:Flt1 APN 5 147,615,109 (GRCm39) missense possibly damaging 0.47
IGL03057:Flt1 APN 5 147,618,734 (GRCm39) nonsense probably null
IGL03196:Flt1 APN 5 147,551,937 (GRCm39) critical splice donor site probably null
IGL03205:Flt1 APN 5 147,636,631 (GRCm39) missense probably benign 0.00
IGL03255:Flt1 APN 5 147,525,331 (GRCm39) splice site probably benign
flywheels UTSW 5 147,536,456 (GRCm39) missense probably damaging 1.00
BB008:Flt1 UTSW 5 147,525,382 (GRCm39) missense probably damaging 1.00
BB018:Flt1 UTSW 5 147,525,382 (GRCm39) missense probably damaging 1.00
IGL02837:Flt1 UTSW 5 147,591,980 (GRCm39) missense probably benign 0.32
PIT4402001:Flt1 UTSW 5 147,615,049 (GRCm39) missense probably damaging 1.00
R0013:Flt1 UTSW 5 147,507,824 (GRCm39) splice site probably benign
R0380:Flt1 UTSW 5 147,525,382 (GRCm39) missense probably damaging 1.00
R0448:Flt1 UTSW 5 147,503,204 (GRCm39) splice site probably benign
R0789:Flt1 UTSW 5 147,576,293 (GRCm39) missense probably damaging 1.00
R1005:Flt1 UTSW 5 147,618,695 (GRCm39) missense probably damaging 0.99
R1241:Flt1 UTSW 5 147,536,456 (GRCm39) missense probably damaging 1.00
R1302:Flt1 UTSW 5 147,501,050 (GRCm39) missense possibly damaging 0.93
R1411:Flt1 UTSW 5 147,517,126 (GRCm39) missense probably damaging 1.00
R1615:Flt1 UTSW 5 147,576,098 (GRCm39) missense probably damaging 1.00
R1634:Flt1 UTSW 5 147,613,240 (GRCm39) missense probably damaging 1.00
R1749:Flt1 UTSW 5 147,591,929 (GRCm39) missense probably benign 0.00
R1768:Flt1 UTSW 5 147,609,519 (GRCm39) missense probably damaging 1.00
R1972:Flt1 UTSW 5 147,591,903 (GRCm39) splice site probably benign
R2081:Flt1 UTSW 5 147,576,232 (GRCm39) missense probably damaging 1.00
R2864:Flt1 UTSW 5 147,531,431 (GRCm39) missense possibly damaging 0.68
R2865:Flt1 UTSW 5 147,531,431 (GRCm39) missense possibly damaging 0.68
R3740:Flt1 UTSW 5 147,536,403 (GRCm39) missense probably damaging 1.00
R3820:Flt1 UTSW 5 147,636,827 (GRCm39) splice site probably benign
R4089:Flt1 UTSW 5 147,501,051 (GRCm39) missense probably benign 0.03
R4299:Flt1 UTSW 5 147,620,717 (GRCm39) missense probably benign 0.00
R4570:Flt1 UTSW 5 147,531,423 (GRCm39) missense probably damaging 1.00
R4812:Flt1 UTSW 5 147,620,749 (GRCm39) missense probably benign 0.30
R4853:Flt1 UTSW 5 147,620,749 (GRCm39) missense probably benign 0.30
R4865:Flt1 UTSW 5 147,620,749 (GRCm39) missense probably benign 0.30
R4900:Flt1 UTSW 5 147,620,749 (GRCm39) missense probably benign 0.30
R4906:Flt1 UTSW 5 147,620,749 (GRCm39) missense probably benign 0.30
R4907:Flt1 UTSW 5 147,620,749 (GRCm39) missense probably benign 0.30
R4909:Flt1 UTSW 5 147,620,749 (GRCm39) missense probably benign 0.30
R5072:Flt1 UTSW 5 147,620,749 (GRCm39) missense probably benign 0.30
R5073:Flt1 UTSW 5 147,620,749 (GRCm39) missense probably benign 0.30
R5074:Flt1 UTSW 5 147,620,749 (GRCm39) missense probably benign 0.30
R5218:Flt1 UTSW 5 147,618,738 (GRCm39) missense probably damaging 1.00
R5547:Flt1 UTSW 5 147,591,948 (GRCm39) missense probably damaging 1.00
R5731:Flt1 UTSW 5 147,614,962 (GRCm39) missense probably benign 0.16
R5732:Flt1 UTSW 5 147,571,293 (GRCm39) nonsense probably null
R5804:Flt1 UTSW 5 147,517,247 (GRCm39) splice site probably null
R6107:Flt1 UTSW 5 147,540,403 (GRCm39) missense probably benign 0.15
R6440:Flt1 UTSW 5 147,501,115 (GRCm39) missense possibly damaging 0.79
R6453:Flt1 UTSW 5 147,620,751 (GRCm39) missense possibly damaging 0.80
R6539:Flt1 UTSW 5 147,515,186 (GRCm39) missense probably benign 0.27
R7068:Flt1 UTSW 5 147,610,444 (GRCm39) missense probably damaging 1.00
R7112:Flt1 UTSW 5 147,540,379 (GRCm39) missense probably damaging 1.00
R7195:Flt1 UTSW 5 147,540,386 (GRCm39) missense probably damaging 1.00
R7255:Flt1 UTSW 5 147,517,216 (GRCm39) missense probably damaging 1.00
R7347:Flt1 UTSW 5 147,517,191 (GRCm39) missense probably damaging 1.00
R7469:Flt1 UTSW 5 147,540,379 (GRCm39) missense probably damaging 1.00
R7473:Flt1 UTSW 5 147,531,405 (GRCm39) missense probably damaging 1.00
R7663:Flt1 UTSW 5 147,591,930 (GRCm39) missense probably benign
R7688:Flt1 UTSW 5 147,613,135 (GRCm39) missense probably benign
R7729:Flt1 UTSW 5 147,637,177 (GRCm39) missense probably benign 0.00
R7931:Flt1 UTSW 5 147,525,382 (GRCm39) missense probably damaging 1.00
R8051:Flt1 UTSW 5 147,519,501 (GRCm39) missense probably benign 0.02
R8275:Flt1 UTSW 5 147,614,957 (GRCm39) missense probably damaging 0.99
R8434:Flt1 UTSW 5 147,576,253 (GRCm39) missense probably damaging 0.97
R8442:Flt1 UTSW 5 147,512,983 (GRCm39) missense probably damaging 1.00
R8756:Flt1 UTSW 5 147,576,224 (GRCm39) missense probably benign 0.07
R8855:Flt1 UTSW 5 147,618,460 (GRCm39) missense probably damaging 1.00
R8855:Flt1 UTSW 5 147,507,682 (GRCm39) missense probably benign 0.00
R9165:Flt1 UTSW 5 147,552,047 (GRCm39) missense probably damaging 0.99
R9240:Flt1 UTSW 5 147,618,676 (GRCm39) missense probably benign
R9439:Flt1 UTSW 5 147,515,207 (GRCm39) missense probably damaging 1.00
R9658:Flt1 UTSW 5 147,525,377 (GRCm39) missense probably damaging 0.97
X0064:Flt1 UTSW 5 147,610,423 (GRCm39) missense probably damaging 1.00
Z1088:Flt1 UTSW 5 147,618,459 (GRCm39) missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- CGGCAACAGACTGCATTTCC -3'
(R):5'- TGATGCAAAGCAGTAGATGTTGTC -3'

Sequencing Primer
(F):5'- GCAACAGACTGCATTTCCTCTGG -3'
(R):5'- TGTGTGTCTCTATTTCTCAG -3'
Posted On 2014-09-17