Incidental Mutation 'R2074:M1ap'
ID227423
Institutional Source Beutler Lab
Gene Symbol M1ap
Ensembl Gene ENSMUSG00000030041
Gene Namemeiosis 1 associated protein
SynonymsD6Mm5e
MMRRC Submission 040079-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R2074 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location82946902-83030309 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 82981882 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 165 (I165V)
Ref Sequence ENSEMBL: ENSMUSP00000109613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113980]
Predicted Effect probably benign
Transcript: ENSMUST00000113980
AA Change: I165V

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000109613
Gene: ENSMUSG00000030041
AA Change: I165V

DomainStartEndE-ValueType
low complexity region 151 163 N/A INTRINSIC
low complexity region 239 250 N/A INTRINSIC
low complexity region 446 457 N/A INTRINSIC
low complexity region 482 500 N/A INTRINSIC
low complexity region 504 512 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is likely to function in progression of meiosis. A similar protein in mouse plays a role in gametogenesis in both sexes. Alternate splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit male infertility with oligospermia, globozooaspermiam decreased testies weight and size, degeneration of seminiferous tubules, male germ cell apoptosis and arrested male meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A T 4: 42,974,171 D1168V probably benign Het
4930430A15Rik T C 2: 111,200,418 E382G probably damaging Het
9130011E15Rik A T 19: 45,965,381 I188K probably damaging Het
Ace C T 11: 105,976,623 Q484* probably null Het
Ackr3 T C 1: 90,213,981 I54T probably damaging Het
Aco1 G A 4: 40,183,605 G508S probably damaging Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Ankef1 T C 2: 136,545,738 S192P possibly damaging Het
Ankrd16 T G 2: 11,789,748 C315G possibly damaging Het
Ankzf1 T C 1: 75,196,243 S328P probably damaging Het
Aqp2 A G 15: 99,583,100 I176V probably benign Het
Arhgap45 A G 10: 80,027,180 Y730C probably damaging Het
Asxl2 A G 12: 3,493,779 E316G probably damaging Het
Btbd17 A T 11: 114,791,952 probably null Het
Calu A G 6: 29,372,615 Y263C probably damaging Het
Ccdc122 T C 14: 77,068,951 probably null Het
Cenpf T C 1: 189,656,901 K1578R probably damaging Het
Cep120 A G 18: 53,719,312 V498A possibly damaging Het
Ces1a T A 8: 93,048,075 N12Y probably benign Het
Chmp1a A T 8: 123,208,022 M65K probably damaging Het
Cnot1 G T 8: 95,739,833 T1592K possibly damaging Het
Cps1 T A 1: 67,204,638 I1091N probably benign Het
Dhx32 T C 7: 133,721,292 N731S probably benign Het
Dhx33 G A 11: 70,999,843 R177W probably damaging Het
Dmd G C X: 84,312,483 A2257P probably benign Het
Dnah10 T C 5: 124,814,674 S3259P probably damaging Het
Dnah7a T C 1: 53,457,696 I3134V probably benign Het
Dock3 A G 9: 106,993,463 F584S possibly damaging Het
Dtnb A G 12: 3,781,273 T658A probably benign Het
Duox2 T A 2: 122,295,158 S323C probably damaging Het
Elovl3 A T 19: 46,132,167 E33V probably damaging Het
Enpp5 T C 17: 44,085,373 F392S probably benign Het
Eogt T C 6: 97,131,376 T235A probably benign Het
Etv3 T C 3: 87,536,219 V370A probably benign Het
Ewsr1 C T 11: 5,071,555 R466H unknown Het
Fam208a T A 14: 27,461,213 I543K probably benign Het
Fcgbp G A 7: 28,120,389 G2514S probably damaging Het
Flt1 A T 5: 147,599,606 D808E possibly damaging Het
Glg1 C T 8: 111,168,671 G836E probably damaging Het
Gm17334 A G 11: 53,772,828 probably benign Het
Gpbp1 A T 13: 111,453,407 D51E probably benign Het
Il12rb2 C G 6: 67,360,552 C115S probably damaging Het
Il1rl1 T C 1: 40,462,044 S527P probably damaging Het
Ireb2 A G 9: 54,881,449 D69G probably benign Het
Kif5a T C 10: 127,245,369 D232G probably damaging Het
Mff T A 1: 82,751,700 L287H probably damaging Het
Mmp27 A G 9: 7,577,739 M311V possibly damaging Het
Mpped2 T A 2: 106,744,802 Y77* probably null Het
Mybbp1a G A 11: 72,441,445 S21N probably benign Het
Obscn G C 11: 59,069,281 I3253M probably damaging Het
Obscn T C 11: 59,132,652 D633G probably damaging Het
Olfr1247 A G 2: 89,609,478 V208A probably benign Het
Olfr1404 A T 1: 173,215,810 D53V probably damaging Het
Olr1 C T 6: 129,502,094 V54I probably benign Het
Phlpp2 T C 8: 109,928,492 S605P possibly damaging Het
Plekhg4 TAGTCGATGCCCGAGTC TAGTC 8: 105,376,452 probably benign Het
Prss8 C A 7: 127,927,094 R148L possibly damaging Het
Psg27 T C 7: 18,560,417 D355G probably damaging Het
Rabgef1 C A 5: 130,187,561 Q52K probably benign Het
Rnf6 C T 5: 146,210,906 R434H probably damaging Het
Rpl26 A G 11: 68,903,273 E88G probably benign Het
Rpn1 T A 6: 88,100,962 L460Q probably damaging Het
Sap130 T A 18: 31,648,279 I165N probably damaging Het
Sash1 A G 10: 8,756,697 V258A probably damaging Het
Scarb1 G T 5: 125,294,143 N288K probably benign Het
Sec16a A G 2: 26,440,239 I588T probably damaging Het
Shank2 C A 7: 144,409,540 S295Y probably damaging Het
Slc15a3 T C 19: 10,857,299 S515P probably damaging Het
Slc25a13 A T 6: 6,114,017 M285K probably benign Het
Slc39a11 A G 11: 113,463,974 I143T probably null Het
Smarcd2 A T 11: 106,265,307 L42* probably null Het
Smc3 A G 19: 53,631,533 D620G probably benign Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Taar4 A C 10: 23,961,173 Q227P probably benign Het
Tecta G T 9: 42,337,279 Y1937* probably null Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tmem130 T A 5: 144,755,274 T107S possibly damaging Het
Tmem132d T C 5: 128,269,131 D109G probably damaging Het
Tmem81 A G 1: 132,507,906 Y150C probably damaging Het
Tnrc18 C T 5: 142,759,706 probably null Het
Trim43a A G 9: 88,586,094 K256R possibly damaging Het
Trpm6 A G 19: 18,877,739 T1921A probably damaging Het
Tubb3 C T 8: 123,421,270 A314V probably damaging Het
Ube3b A C 5: 114,415,255 N896T probably benign Het
Unc80 G A 1: 66,679,744 probably null Het
Upb1 A G 10: 75,424,513 T134A probably damaging Het
Vmn2r15 A T 5: 109,286,753 M695K possibly damaging Het
Wwc1 G T 11: 35,889,353 D258E possibly damaging Het
Zfp619 T A 7: 39,534,761 Y72N probably benign Het
Zfp672 G T 11: 58,316,636 H286Q possibly damaging Het
Other mutations in M1ap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00666:M1ap APN 6 82956665 missense probably damaging 1.00
IGL01511:M1ap APN 6 83028412 missense probably benign 0.00
IGL01803:M1ap APN 6 83005584 missense probably benign 0.01
IGL02243:M1ap APN 6 83026288 missense probably damaging 1.00
R1799:M1ap UTSW 6 83005510 nonsense probably null
R2073:M1ap UTSW 6 82981882 missense probably benign 0.05
R2355:M1ap UTSW 6 82956503 missense probably benign 0.00
R4063:M1ap UTSW 6 83003775 missense probably damaging 1.00
R5024:M1ap UTSW 6 83028358 unclassified probably benign
R5029:M1ap UTSW 6 83003832 missense probably damaging 1.00
R5564:M1ap UTSW 6 82981817 missense probably damaging 1.00
R5740:M1ap UTSW 6 82981922 missense probably damaging 0.96
R5821:M1ap UTSW 6 82968102 missense probably benign 0.11
R5860:M1ap UTSW 6 83003814 missense probably damaging 1.00
R6190:M1ap UTSW 6 83003896 missense possibly damaging 0.60
R6773:M1ap UTSW 6 82968080 missense probably damaging 1.00
R7350:M1ap UTSW 6 82981949 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- TTGTACTAAACACACCAGCTGC -3'
(R):5'- GGAAAACTTGGATCATTCTCTCC -3'

Sequencing Primer
(F):5'- GCTGCTACCAGAGACAACAGATTG -3'
(R):5'- CCTCTGTAAGGCCAATGAGTGATC -3'
Posted On2014-09-17