Incidental Mutation 'R2074:Shank2'
ID227432
Institutional Source Beutler Lab
Gene Symbol Shank2
Ensembl Gene ENSMUSG00000037541
Gene NameSH3 and multiple ankyrin repeat domains 2
SynonymsProSAP1
MMRRC Submission 040079-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2074 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location144001928-144424494 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 144409540 bp
ZygosityHeterozygous
Amino Acid Change Serine to Tyrosine at position 295 (S295Y)
Ref Sequence ENSEMBL: ENSMUSP00000146440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097929] [ENSMUST00000105900] [ENSMUST00000105902] [ENSMUST00000146006]
Predicted Effect probably damaging
Transcript: ENSMUST00000097929
AA Change: S288Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095542
Gene: ENSMUSG00000037541
AA Change: S288Y

DomainStartEndE-ValueType
PDZ 46 131 1.75e-14 SMART
low complexity region 135 154 N/A INTRINSIC
low complexity region 299 314 N/A INTRINSIC
low complexity region 452 464 N/A INTRINSIC
low complexity region 539 550 N/A INTRINSIC
low complexity region 570 582 N/A INTRINSIC
low complexity region 619 637 N/A INTRINSIC
low complexity region 814 828 N/A INTRINSIC
low complexity region 883 894 N/A INTRINSIC
low complexity region 915 937 N/A INTRINSIC
low complexity region 951 967 N/A INTRINSIC
low complexity region 989 997 N/A INTRINSIC
low complexity region 1077 1091 N/A INTRINSIC
low complexity region 1134 1149 N/A INTRINSIC
low complexity region 1173 1187 N/A INTRINSIC
SAM 1196 1262 2.52e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105900
AA Change: S505Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101520
Gene: ENSMUSG00000037541
AA Change: S505Y

DomainStartEndE-ValueType
SH3 150 205 1.04e-14 SMART
PDZ 256 341 1.75e-14 SMART
low complexity region 345 364 N/A INTRINSIC
low complexity region 509 524 N/A INTRINSIC
low complexity region 662 674 N/A INTRINSIC
low complexity region 749 760 N/A INTRINSIC
low complexity region 780 792 N/A INTRINSIC
low complexity region 829 847 N/A INTRINSIC
low complexity region 1024 1038 N/A INTRINSIC
low complexity region 1093 1104 N/A INTRINSIC
low complexity region 1125 1147 N/A INTRINSIC
low complexity region 1161 1177 N/A INTRINSIC
low complexity region 1199 1207 N/A INTRINSIC
low complexity region 1287 1301 N/A INTRINSIC
low complexity region 1344 1359 N/A INTRINSIC
low complexity region 1383 1397 N/A INTRINSIC
SAM 1406 1472 2.52e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105902
AA Change: S874Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101522
Gene: ENSMUSG00000037541
AA Change: S874Y

DomainStartEndE-ValueType
low complexity region 15 28 N/A INTRINSIC
Pfam:FERM_f0 57 140 1.4e-21 PFAM
ANK 196 226 1.4e1 SMART
ANK 230 259 2.77e-3 SMART
ANK 263 293 1.42e0 SMART
ANK 297 326 1.25e-1 SMART
ANK 330 359 7.83e-3 SMART
ANK 363 391 1.29e2 SMART
SH3 529 584 1.04e-14 SMART
PDZ 635 720 1.75e-14 SMART
low complexity region 724 743 N/A INTRINSIC
low complexity region 878 893 N/A INTRINSIC
low complexity region 1031 1043 N/A INTRINSIC
low complexity region 1118 1129 N/A INTRINSIC
low complexity region 1149 1161 N/A INTRINSIC
low complexity region 1198 1216 N/A INTRINSIC
low complexity region 1393 1407 N/A INTRINSIC
low complexity region 1462 1473 N/A INTRINSIC
low complexity region 1494 1516 N/A INTRINSIC
low complexity region 1530 1546 N/A INTRINSIC
low complexity region 1568 1576 N/A INTRINSIC
low complexity region 1656 1670 N/A INTRINSIC
low complexity region 1713 1728 N/A INTRINSIC
low complexity region 1752 1766 N/A INTRINSIC
SAM 1775 1841 2.52e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125355
Predicted Effect probably damaging
Transcript: ENSMUST00000146006
AA Change: S295Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a member of the Shank family of synaptic proteins that may function as molecular scaffolds in the postsynaptic density of excitatory synapses. Shank proteins contain multiple domains for protein-protein interaction, including ankyrin repeats, and an SH3 domain. This particular family member contains a PDZ domain, a consensus sequence for cortactin SH3 domain-binding peptides and a sterile alpha motif. The alternative splicing demonstrated in Shank genes has been suggested as a mechanism for regulating the molecular structure of Shank and the spectrum of Shank-interacting proteins in the postsynaptic densities of the adult and developing brain. Alterations in the encoded protein may be associated with susceptibility to autism spectrum disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for null mutations display hyperactivity and abnormal social behavior. Mice homozygous for one null allele also display partial postnal lethality and limb grasping. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A T 4: 42,974,171 D1168V probably benign Het
4930430A15Rik T C 2: 111,200,418 E382G probably damaging Het
9130011E15Rik A T 19: 45,965,381 I188K probably damaging Het
Ace C T 11: 105,976,623 Q484* probably null Het
Ackr3 T C 1: 90,213,981 I54T probably damaging Het
Aco1 G A 4: 40,183,605 G508S probably damaging Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Ankef1 T C 2: 136,545,738 S192P possibly damaging Het
Ankrd16 T G 2: 11,789,748 C315G possibly damaging Het
Ankzf1 T C 1: 75,196,243 S328P probably damaging Het
Aqp2 A G 15: 99,583,100 I176V probably benign Het
Arhgap45 A G 10: 80,027,180 Y730C probably damaging Het
Asxl2 A G 12: 3,493,779 E316G probably damaging Het
Btbd17 A T 11: 114,791,952 probably null Het
Calu A G 6: 29,372,615 Y263C probably damaging Het
Ccdc122 T C 14: 77,068,951 probably null Het
Cenpf T C 1: 189,656,901 K1578R probably damaging Het
Cep120 A G 18: 53,719,312 V498A possibly damaging Het
Ces1a T A 8: 93,048,075 N12Y probably benign Het
Chmp1a A T 8: 123,208,022 M65K probably damaging Het
Cnot1 G T 8: 95,739,833 T1592K possibly damaging Het
Cps1 T A 1: 67,204,638 I1091N probably benign Het
Dhx32 T C 7: 133,721,292 N731S probably benign Het
Dhx33 G A 11: 70,999,843 R177W probably damaging Het
Dmd G C X: 84,312,483 A2257P probably benign Het
Dnah10 T C 5: 124,814,674 S3259P probably damaging Het
Dnah7a T C 1: 53,457,696 I3134V probably benign Het
Dock3 A G 9: 106,993,463 F584S possibly damaging Het
Dtnb A G 12: 3,781,273 T658A probably benign Het
Duox2 T A 2: 122,295,158 S323C probably damaging Het
Elovl3 A T 19: 46,132,167 E33V probably damaging Het
Enpp5 T C 17: 44,085,373 F392S probably benign Het
Eogt T C 6: 97,131,376 T235A probably benign Het
Etv3 T C 3: 87,536,219 V370A probably benign Het
Ewsr1 C T 11: 5,071,555 R466H unknown Het
Fam208a T A 14: 27,461,213 I543K probably benign Het
Fcgbp G A 7: 28,120,389 G2514S probably damaging Het
Flt1 A T 5: 147,599,606 D808E possibly damaging Het
Glg1 C T 8: 111,168,671 G836E probably damaging Het
Gm17334 A G 11: 53,772,828 probably benign Het
Gpbp1 A T 13: 111,453,407 D51E probably benign Het
Il12rb2 C G 6: 67,360,552 C115S probably damaging Het
Il1rl1 T C 1: 40,462,044 S527P probably damaging Het
Ireb2 A G 9: 54,881,449 D69G probably benign Het
Kif5a T C 10: 127,245,369 D232G probably damaging Het
M1ap A G 6: 82,981,882 I165V probably benign Het
Mff T A 1: 82,751,700 L287H probably damaging Het
Mmp27 A G 9: 7,577,739 M311V possibly damaging Het
Mpped2 T A 2: 106,744,802 Y77* probably null Het
Mybbp1a G A 11: 72,441,445 S21N probably benign Het
Obscn G C 11: 59,069,281 I3253M probably damaging Het
Obscn T C 11: 59,132,652 D633G probably damaging Het
Olfr1247 A G 2: 89,609,478 V208A probably benign Het
Olfr1404 A T 1: 173,215,810 D53V probably damaging Het
Olr1 C T 6: 129,502,094 V54I probably benign Het
Phlpp2 T C 8: 109,928,492 S605P possibly damaging Het
Plekhg4 TAGTCGATGCCCGAGTC TAGTC 8: 105,376,452 probably benign Het
Prss8 C A 7: 127,927,094 R148L possibly damaging Het
Psg27 T C 7: 18,560,417 D355G probably damaging Het
Rabgef1 C A 5: 130,187,561 Q52K probably benign Het
Rnf6 C T 5: 146,210,906 R434H probably damaging Het
Rpl26 A G 11: 68,903,273 E88G probably benign Het
Rpn1 T A 6: 88,100,962 L460Q probably damaging Het
Sap130 T A 18: 31,648,279 I165N probably damaging Het
Sash1 A G 10: 8,756,697 V258A probably damaging Het
Scarb1 G T 5: 125,294,143 N288K probably benign Het
Sec16a A G 2: 26,440,239 I588T probably damaging Het
Slc15a3 T C 19: 10,857,299 S515P probably damaging Het
Slc25a13 A T 6: 6,114,017 M285K probably benign Het
Slc39a11 A G 11: 113,463,974 I143T probably null Het
Smarcd2 A T 11: 106,265,307 L42* probably null Het
Smc3 A G 19: 53,631,533 D620G probably benign Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Taar4 A C 10: 23,961,173 Q227P probably benign Het
Tecta G T 9: 42,337,279 Y1937* probably null Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tmem130 T A 5: 144,755,274 T107S possibly damaging Het
Tmem132d T C 5: 128,269,131 D109G probably damaging Het
Tmem81 A G 1: 132,507,906 Y150C probably damaging Het
Tnrc18 C T 5: 142,759,706 probably null Het
Trim43a A G 9: 88,586,094 K256R possibly damaging Het
Trpm6 A G 19: 18,877,739 T1921A probably damaging Het
Tubb3 C T 8: 123,421,270 A314V probably damaging Het
Ube3b A C 5: 114,415,255 N896T probably benign Het
Unc80 G A 1: 66,679,744 probably null Het
Upb1 A G 10: 75,424,513 T134A probably damaging Het
Vmn2r15 A T 5: 109,286,753 M695K possibly damaging Het
Wwc1 G T 11: 35,889,353 D258E possibly damaging Het
Zfp619 T A 7: 39,534,761 Y72N probably benign Het
Zfp672 G T 11: 58,316,636 H286Q possibly damaging Het
Other mutations in Shank2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Shank2 APN 7 144411847 missense probably damaging 1.00
IGL00516:Shank2 APN 7 144410775 missense possibly damaging 0.96
IGL00919:Shank2 APN 7 144411271 missense probably damaging 0.97
IGL01450:Shank2 APN 7 144285068 nonsense probably null
IGL01996:Shank2 APN 7 144411493 missense probably damaging 1.00
IGL02217:Shank2 APN 7 144285047 missense possibly damaging 0.59
IGL02314:Shank2 APN 7 144411271 missense probably benign 0.01
IGL02320:Shank2 APN 7 144420944 missense probably damaging 1.00
IGL02948:Shank2 APN 7 144409636 missense probably benign 0.03
IGL02997:Shank2 APN 7 144081873 missense probably benign 0.16
R0077:Shank2 UTSW 7 144192467 missense possibly damaging 0.85
R0109:Shank2 UTSW 7 144410577 missense possibly damaging 0.81
R0126:Shank2 UTSW 7 144031355 missense probably damaging 0.99
R0153:Shank2 UTSW 7 144070135 missense probably benign 0.04
R0644:Shank2 UTSW 7 144411849 missense probably benign
R1072:Shank2 UTSW 7 144411568 missense probably damaging 1.00
R1245:Shank2 UTSW 7 144411720 missense probably benign 0.00
R1424:Shank2 UTSW 7 144052372 missense probably damaging 0.99
R1712:Shank2 UTSW 7 144411153 missense probably damaging 1.00
R1739:Shank2 UTSW 7 144179853 missense probably damaging 1.00
R1791:Shank2 UTSW 7 144410599 missense probably damaging 1.00
R1889:Shank2 UTSW 7 144186858 nonsense probably null
R2135:Shank2 UTSW 7 144411234 missense probably damaging 0.99
R2355:Shank2 UTSW 7 144057718 missense possibly damaging 0.94
R2511:Shank2 UTSW 7 144411577 missense probably damaging 1.00
R2517:Shank2 UTSW 7 144052305 missense possibly damaging 0.89
R2570:Shank2 UTSW 7 144068770 missense probably damaging 1.00
R2846:Shank2 UTSW 7 144070055 missense probably damaging 1.00
R3159:Shank2 UTSW 7 144081874 missense probably damaging 0.98
R3881:Shank2 UTSW 7 144405384 missense probably benign
R3907:Shank2 UTSW 7 144409576 missense probably damaging 1.00
R3938:Shank2 UTSW 7 144128375 missense probably benign 0.20
R4151:Shank2 UTSW 7 144054828 missense probably damaging 1.00
R4369:Shank2 UTSW 7 144179781 missense probably damaging 0.99
R4372:Shank2 UTSW 7 144410862 missense probably benign 0.09
R4519:Shank2 UTSW 7 144410205 missense probably damaging 1.00
R4627:Shank2 UTSW 7 144411424 missense probably damaging 1.00
R4645:Shank2 UTSW 7 144410422 missense possibly damaging 0.65
R4647:Shank2 UTSW 7 144411829 missense probably damaging 1.00
R4689:Shank2 UTSW 7 144420605 missense probably benign 0.07
R4751:Shank2 UTSW 7 144409468 missense probably damaging 1.00
R4816:Shank2 UTSW 7 144052306 missense probably damaging 1.00
R4843:Shank2 UTSW 7 144031409 missense probably benign 0.17
R4929:Shank2 UTSW 7 144411271 missense probably benign 0.01
R5009:Shank2 UTSW 7 144070179 missense probably benign 0.00
R5027:Shank2 UTSW 7 144259105 nonsense probably null
R5165:Shank2 UTSW 7 144409636 missense possibly damaging 0.62
R5278:Shank2 UTSW 7 144068875 critical splice donor site probably null
R5332:Shank2 UTSW 7 144411292 missense possibly damaging 0.82
R5497:Shank2 UTSW 7 144409534 missense probably damaging 1.00
R5525:Shank2 UTSW 7 144070109 missense probably damaging 1.00
R5575:Shank2 UTSW 7 144410134 missense probably damaging 1.00
R5948:Shank2 UTSW 7 144407223 missense probably damaging 0.98
R6024:Shank2 UTSW 7 144180031 missense probably benign 0.12
R6306:Shank2 UTSW 7 144409680 missense probably benign 0.00
R6317:Shank2 UTSW 7 144285084 missense possibly damaging 0.89
R6358:Shank2 UTSW 7 144031297 missense probably benign 0.25
R6364:Shank2 UTSW 7 144410409 missense probably benign 0.14
R6413:Shank2 UTSW 7 144410218 missense probably damaging 1.00
R6680:Shank2 UTSW 7 144420866 missense probably damaging 1.00
R6834:Shank2 UTSW 7 144409894 missense probably damaging 1.00
R6870:Shank2 UTSW 7 144052460 missense probably damaging 0.99
R6933:Shank2 UTSW 7 144091778 missense probably benign 0.19
R6983:Shank2 UTSW 7 144081848 missense possibly damaging 0.94
R7082:Shank2 UTSW 7 144410359 missense probably damaging 0.99
R7100:Shank2 UTSW 7 144411164 missense possibly damaging 0.73
R7111:Shank2 UTSW 7 144411552 missense probably benign 0.00
R7213:Shank2 UTSW 7 144031409 missense probably benign 0.17
R7225:Shank2 UTSW 7 144285025 missense probably benign 0.42
R7325:Shank2 UTSW 7 144411685 missense probably benign 0.04
R7605:Shank2 UTSW 7 144091779 missense possibly damaging 0.64
R7909:Shank2 UTSW 7 144411394 missense probably damaging 1.00
R7976:Shank2 UTSW 7 144411061 missense probably damaging 0.99
R8118:Shank2 UTSW 7 144409875 missense probably benign 0.01
RF009:Shank2 UTSW 7 144411571 missense possibly damaging 0.81
Z1176:Shank2 UTSW 7 144128377 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTGCTGTGCTTCCTAACAAG -3'
(R):5'- CTTTTCCCGCATCATGGTGG -3'

Sequencing Primer
(F):5'- AACAAGTGTCTCCTGTCTGAG -3'
(R):5'- ATCATGGTGGCCACAGTGTCAG -3'
Posted On2014-09-17