Incidental Mutation 'R2074:Cnot1'
ID 227434
Institutional Source Beutler Lab
Gene Symbol Cnot1
Ensembl Gene ENSMUSG00000036550
Gene Name CCR4-NOT transcription complex, subunit 1
Synonyms 6030411K04Rik
MMRRC Submission 040079-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2074 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 96446079-96534092 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 96466461 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 1592 (T1592K)
Ref Sequence ENSEMBL: ENSMUSP00000148735 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068452] [ENSMUST00000098473] [ENSMUST00000211887] [ENSMUST00000213006]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000068452
AA Change: T1587K

PolyPhen 2 Score 0.526 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000063565
Gene: ENSMUSG00000036550
AA Change: T1587K

DomainStartEndE-ValueType
low complexity region 181 189 N/A INTRINSIC
low complexity region 687 698 N/A INTRINSIC
low complexity region 779 796 N/A INTRINSIC
PDB:4J8S|A 798 999 1e-137 PDB
low complexity region 1011 1028 N/A INTRINSIC
low complexity region 1031 1055 N/A INTRINSIC
PDB:4CT4|C 1056 1295 1e-148 PDB
low complexity region 1296 1308 N/A INTRINSIC
low complexity region 1328 1345 N/A INTRINSIC
Pfam:DUF3819 1381 1530 2.5e-56 PFAM
low complexity region 1634 1648 N/A INTRINSIC
Pfam:Not1 1991 2305 2.4e-125 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098473
AA Change: T1592K

PolyPhen 2 Score 0.175 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000096073
Gene: ENSMUSG00000036550
AA Change: T1592K

DomainStartEndE-ValueType
low complexity region 181 189 N/A INTRINSIC
Pfam:CNOT1_HEAT 500 656 2.4e-57 PFAM
low complexity region 687 698 N/A INTRINSIC
low complexity region 779 796 N/A INTRINSIC
Pfam:CNOT1_TTP_bind 812 1004 1.4e-87 PFAM
low complexity region 1016 1033 N/A INTRINSIC
low complexity region 1036 1060 N/A INTRINSIC
Pfam:CNOT1_CAF1_bind 1087 1313 5.7e-99 PFAM
low complexity region 1333 1350 N/A INTRINSIC
Pfam:DUF3819 1387 1534 2.3e-57 PFAM
low complexity region 1639 1653 N/A INTRINSIC
Pfam:Not1 1998 2357 5.7e-157 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000211887
AA Change: T1585K

PolyPhen 2 Score 0.677 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect probably benign
Transcript: ENSMUST00000211973
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212195
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212340
Predicted Effect probably benign
Transcript: ENSMUST00000212415
Predicted Effect possibly damaging
Transcript: ENSMUST00000213006
AA Change: T1592K

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212712
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice hmozygous for a conditional allele activated in cardiomyocytes exhibit postnatal lethality, decreased cardiac muscle contractility, prolonged QT interval and cardiac muscle cell death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace C T 11: 105,867,449 (GRCm39) Q484* probably null Het
Ackr3 T C 1: 90,141,703 (GRCm39) I54T probably damaging Het
Aco1 G A 4: 40,183,605 (GRCm39) G508S probably damaging Het
Akap8l C T 17: 32,551,457 (GRCm39) R511H probably damaging Het
Ankef1 T C 2: 136,387,658 (GRCm39) S192P possibly damaging Het
Ankrd16 T G 2: 11,794,559 (GRCm39) C315G possibly damaging Het
Ankzf1 T C 1: 75,172,887 (GRCm39) S328P probably damaging Het
Aqp2 A G 15: 99,480,981 (GRCm39) I176V probably benign Het
Arhgap45 A G 10: 79,863,014 (GRCm39) Y730C probably damaging Het
Armh3 A T 19: 45,953,820 (GRCm39) I188K probably damaging Het
Asxl2 A G 12: 3,543,779 (GRCm39) E316G probably damaging Het
Btbd17 A T 11: 114,682,778 (GRCm39) probably null Het
Calu A G 6: 29,372,614 (GRCm39) Y263C probably damaging Het
Ccdc122 T C 14: 77,306,391 (GRCm39) probably null Het
Cenpf T C 1: 189,389,098 (GRCm39) K1578R probably damaging Het
Cep120 A G 18: 53,852,384 (GRCm39) V498A possibly damaging Het
Ces1a T A 8: 93,774,703 (GRCm39) N12Y probably benign Het
Chmp1a A T 8: 123,934,761 (GRCm39) M65K probably damaging Het
Cps1 T A 1: 67,243,797 (GRCm39) I1091N probably benign Het
Dhx32 T C 7: 133,323,021 (GRCm39) N731S probably benign Het
Dhx33 G A 11: 70,890,669 (GRCm39) R177W probably damaging Het
Dmd G C X: 83,356,089 (GRCm39) A2257P probably benign Het
Dnah10 T C 5: 124,891,738 (GRCm39) S3259P probably damaging Het
Dnah7a T C 1: 53,496,855 (GRCm39) I3134V probably benign Het
Dock3 A G 9: 106,870,662 (GRCm39) F584S possibly damaging Het
Dtnb A G 12: 3,831,273 (GRCm39) T658A probably benign Het
Duox2 T A 2: 122,125,639 (GRCm39) S323C probably damaging Het
Elovl3 A T 19: 46,120,606 (GRCm39) E33V probably damaging Het
Enpp5 T C 17: 44,396,264 (GRCm39) F392S probably benign Het
Eogt T C 6: 97,108,337 (GRCm39) T235A probably benign Het
Etv3 T C 3: 87,443,526 (GRCm39) V370A probably benign Het
Ewsr1 C T 11: 5,021,555 (GRCm39) R466H unknown Het
Fcgbp G A 7: 27,819,814 (GRCm39) G2514S probably damaging Het
Flt1 A T 5: 147,536,416 (GRCm39) D808E possibly damaging Het
Glg1 C T 8: 111,895,303 (GRCm39) G836E probably damaging Het
Gm17334 A G 11: 53,663,654 (GRCm39) probably benign Het
Gpbp1 A T 13: 111,589,941 (GRCm39) D51E probably benign Het
Il12rb2 C G 6: 67,337,536 (GRCm39) C115S probably damaging Het
Il1rl1 T C 1: 40,501,204 (GRCm39) S527P probably damaging Het
Ireb2 A G 9: 54,788,733 (GRCm39) D69G probably benign Het
Kif5a T C 10: 127,081,238 (GRCm39) D232G probably damaging Het
M1ap A G 6: 82,958,863 (GRCm39) I165V probably benign Het
Mff T A 1: 82,729,421 (GRCm39) L287H probably damaging Het
Mmp27 A G 9: 7,577,740 (GRCm39) M311V possibly damaging Het
Mpped2 T A 2: 106,575,147 (GRCm39) Y77* probably null Het
Mybbp1a G A 11: 72,332,271 (GRCm39) S21N probably benign Het
Obscn G C 11: 58,960,107 (GRCm39) I3253M probably damaging Het
Obscn T C 11: 59,023,478 (GRCm39) D633G probably damaging Het
Olr1 C T 6: 129,479,057 (GRCm39) V54I probably benign Het
Or10j3b A T 1: 173,043,377 (GRCm39) D53V probably damaging Het
Or4a74 A G 2: 89,439,822 (GRCm39) V208A probably benign Het
Phlpp2 T C 8: 110,655,124 (GRCm39) S605P possibly damaging Het
Plekhg4 TAGTCGATGCCCGAGTC TAGTC 8: 106,103,084 (GRCm39) probably benign Het
Potefam1 T C 2: 111,030,763 (GRCm39) E382G probably damaging Het
Prss8 C A 7: 127,526,266 (GRCm39) R148L possibly damaging Het
Psg27 T C 7: 18,294,342 (GRCm39) D355G probably damaging Het
Rabgef1 C A 5: 130,216,402 (GRCm39) Q52K probably benign Het
Rnf6 C T 5: 146,147,716 (GRCm39) R434H probably damaging Het
Rpl26 A G 11: 68,794,099 (GRCm39) E88G probably benign Het
Rpn1 T A 6: 88,077,944 (GRCm39) L460Q probably damaging Het
Sap130 T A 18: 31,781,332 (GRCm39) I165N probably damaging Het
Sash1 A G 10: 8,632,461 (GRCm39) V258A probably damaging Het
Scarb1 G T 5: 125,371,207 (GRCm39) N288K probably benign Het
Sec16a A G 2: 26,330,251 (GRCm39) I588T probably damaging Het
Shank2 C A 7: 143,963,277 (GRCm39) S295Y probably damaging Het
Slc15a3 T C 19: 10,834,663 (GRCm39) S515P probably damaging Het
Slc25a13 A T 6: 6,114,017 (GRCm39) M285K probably benign Het
Slc39a11 A G 11: 113,354,800 (GRCm39) I143T probably null Het
Smarcd2 A T 11: 106,156,133 (GRCm39) L42* probably null Het
Smc3 A G 19: 53,619,964 (GRCm39) D620G probably benign Het
Spata31g1 A T 4: 42,974,171 (GRCm39) D1168V probably benign Het
Syt10 C T 15: 89,674,979 (GRCm39) D456N probably damaging Het
Taar4 A C 10: 23,837,071 (GRCm39) Q227P probably benign Het
Tasor T A 14: 27,183,170 (GRCm39) I543K probably benign Het
Tecta G T 9: 42,248,575 (GRCm39) Y1937* probably null Het
Tex10 C T 4: 48,456,800 (GRCm39) R637Q probably benign Het
Tmem130 T A 5: 144,692,084 (GRCm39) T107S possibly damaging Het
Tmem132d T C 5: 128,346,195 (GRCm39) D109G probably damaging Het
Tmem81 A G 1: 132,435,644 (GRCm39) Y150C probably damaging Het
Tnrc18 C T 5: 142,745,461 (GRCm39) probably null Het
Trim43a A G 9: 88,468,147 (GRCm39) K256R possibly damaging Het
Trpm6 A G 19: 18,855,103 (GRCm39) T1921A probably damaging Het
Tubb3 C T 8: 124,148,009 (GRCm39) A314V probably damaging Het
Ube3b A C 5: 114,553,316 (GRCm39) N896T probably benign Het
Unc80 G A 1: 66,718,903 (GRCm39) probably null Het
Upb1 A G 10: 75,260,347 (GRCm39) T134A probably damaging Het
Vmn2r15 A T 5: 109,434,619 (GRCm39) M695K possibly damaging Het
Wwc1 G T 11: 35,780,180 (GRCm39) D258E possibly damaging Het
Zfp619 T A 7: 39,184,185 (GRCm39) Y72N probably benign Het
Zfp672 G T 11: 58,207,462 (GRCm39) H286Q possibly damaging Het
Other mutations in Cnot1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Cnot1 APN 8 96,452,707 (GRCm39) missense probably damaging 1.00
IGL01340:Cnot1 APN 8 96,487,165 (GRCm39) missense probably damaging 1.00
IGL01457:Cnot1 APN 8 96,467,637 (GRCm39) missense probably damaging 1.00
IGL01505:Cnot1 APN 8 96,455,346 (GRCm39) missense probably damaging 0.98
IGL02401:Cnot1 APN 8 96,482,761 (GRCm39) missense possibly damaging 0.95
IGL02693:Cnot1 APN 8 96,500,113 (GRCm39) missense probably damaging 1.00
IGL02696:Cnot1 APN 8 96,471,645 (GRCm39) missense probably benign 0.00
IGL02754:Cnot1 APN 8 96,481,706 (GRCm39) missense probably benign 0.03
IGL03092:Cnot1 APN 8 96,496,243 (GRCm39) intron probably benign
IGL03174:Cnot1 APN 8 96,487,983 (GRCm39) missense probably damaging 1.00
IGL03310:Cnot1 APN 8 96,462,308 (GRCm39) splice site probably benign
IGL03371:Cnot1 APN 8 96,501,344 (GRCm39) missense possibly damaging 0.85
Affiliate UTSW 8 96,491,753 (GRCm39) missense probably damaging 0.99
Barge UTSW 8 96,460,757 (GRCm39) missense probably benign 0.13
Byproduct UTSW 8 96,472,275 (GRCm39) frame shift probably null
Chairman UTSW 8 96,491,655 (GRCm39) missense possibly damaging 0.95
cohort UTSW 8 96,462,377 (GRCm39) missense probably damaging 0.99
Director UTSW 8 96,491,690 (GRCm39) missense probably benign 0.15
kowloon UTSW 8 96,515,286 (GRCm39) missense probably damaging 1.00
Quorum UTSW 8 96,452,746 (GRCm39) missense probably damaging 1.00
tugboat UTSW 8 96,500,246 (GRCm39) missense probably damaging 0.99
Xiao UTSW 8 96,457,048 (GRCm39) missense probably damaging 1.00
BB001:Cnot1 UTSW 8 96,472,275 (GRCm39) frame shift probably null
BB003:Cnot1 UTSW 8 96,472,275 (GRCm39) frame shift probably null
BB011:Cnot1 UTSW 8 96,472,275 (GRCm39) frame shift probably null
BB013:Cnot1 UTSW 8 96,472,275 (GRCm39) frame shift probably null
R0008:Cnot1 UTSW 8 96,487,969 (GRCm39) missense probably damaging 1.00
R0008:Cnot1 UTSW 8 96,487,969 (GRCm39) missense probably damaging 1.00
R0091:Cnot1 UTSW 8 96,489,772 (GRCm39) missense probably damaging 1.00
R0335:Cnot1 UTSW 8 96,498,628 (GRCm39) missense probably benign 0.02
R0409:Cnot1 UTSW 8 96,475,483 (GRCm39) missense probably damaging 0.96
R0445:Cnot1 UTSW 8 96,486,836 (GRCm39) missense probably damaging 1.00
R1505:Cnot1 UTSW 8 96,455,295 (GRCm39) missense probably damaging 1.00
R1517:Cnot1 UTSW 8 96,469,841 (GRCm39) missense probably benign 0.38
R1640:Cnot1 UTSW 8 96,496,460 (GRCm39) missense probably damaging 0.98
R1737:Cnot1 UTSW 8 96,474,904 (GRCm39) missense probably damaging 0.98
R1755:Cnot1 UTSW 8 96,451,205 (GRCm39) missense probably damaging 1.00
R1901:Cnot1 UTSW 8 96,469,749 (GRCm39) missense possibly damaging 0.50
R1902:Cnot1 UTSW 8 96,469,749 (GRCm39) missense possibly damaging 0.50
R1903:Cnot1 UTSW 8 96,469,749 (GRCm39) missense possibly damaging 0.50
R1988:Cnot1 UTSW 8 96,468,572 (GRCm39) missense possibly damaging 0.89
R2051:Cnot1 UTSW 8 96,451,221 (GRCm39) missense possibly damaging 0.47
R2054:Cnot1 UTSW 8 96,466,469 (GRCm39) missense possibly damaging 0.55
R2072:Cnot1 UTSW 8 96,466,461 (GRCm39) missense possibly damaging 0.89
R2075:Cnot1 UTSW 8 96,466,461 (GRCm39) missense possibly damaging 0.89
R2093:Cnot1 UTSW 8 96,501,986 (GRCm39) missense probably damaging 1.00
R2116:Cnot1 UTSW 8 96,452,781 (GRCm39) missense probably damaging 1.00
R2191:Cnot1 UTSW 8 96,488,054 (GRCm39) missense probably damaging 0.98
R2238:Cnot1 UTSW 8 96,496,149 (GRCm39) missense probably benign 0.04
R2239:Cnot1 UTSW 8 96,496,149 (GRCm39) missense probably benign 0.04
R2251:Cnot1 UTSW 8 96,489,814 (GRCm39) missense probably benign 0.00
R2252:Cnot1 UTSW 8 96,489,814 (GRCm39) missense probably benign 0.00
R2253:Cnot1 UTSW 8 96,489,814 (GRCm39) missense probably benign 0.00
R2315:Cnot1 UTSW 8 96,475,690 (GRCm39) missense probably damaging 1.00
R2431:Cnot1 UTSW 8 96,501,280 (GRCm39) missense probably damaging 1.00
R2988:Cnot1 UTSW 8 96,470,906 (GRCm39) missense possibly damaging 0.80
R2989:Cnot1 UTSW 8 96,470,906 (GRCm39) missense possibly damaging 0.80
R3108:Cnot1 UTSW 8 96,462,377 (GRCm39) missense probably damaging 0.99
R3109:Cnot1 UTSW 8 96,462,377 (GRCm39) missense probably damaging 0.99
R3114:Cnot1 UTSW 8 96,470,906 (GRCm39) missense possibly damaging 0.80
R3115:Cnot1 UTSW 8 96,470,906 (GRCm39) missense possibly damaging 0.80
R3153:Cnot1 UTSW 8 96,470,906 (GRCm39) missense possibly damaging 0.80
R3154:Cnot1 UTSW 8 96,470,906 (GRCm39) missense possibly damaging 0.80
R4112:Cnot1 UTSW 8 96,500,246 (GRCm39) missense probably damaging 0.99
R4359:Cnot1 UTSW 8 96,466,476 (GRCm39) missense probably damaging 1.00
R4382:Cnot1 UTSW 8 96,496,407 (GRCm39) missense probably damaging 0.97
R4747:Cnot1 UTSW 8 96,501,310 (GRCm39) missense probably benign 0.27
R4910:Cnot1 UTSW 8 96,459,859 (GRCm39) missense probably benign 0.43
R4913:Cnot1 UTSW 8 96,489,695 (GRCm39) missense possibly damaging 0.63
R4971:Cnot1 UTSW 8 96,448,254 (GRCm39) missense probably damaging 1.00
R5056:Cnot1 UTSW 8 96,467,636 (GRCm39) missense probably damaging 1.00
R5092:Cnot1 UTSW 8 96,479,396 (GRCm39) missense possibly damaging 0.91
R5101:Cnot1 UTSW 8 96,486,815 (GRCm39) missense possibly damaging 0.90
R5498:Cnot1 UTSW 8 96,483,983 (GRCm39) missense possibly damaging 0.92
R5719:Cnot1 UTSW 8 96,470,924 (GRCm39) missense possibly damaging 0.92
R5850:Cnot1 UTSW 8 96,460,775 (GRCm39) nonsense probably null
R5956:Cnot1 UTSW 8 96,481,606 (GRCm39) critical splice donor site probably null
R5981:Cnot1 UTSW 8 96,515,293 (GRCm39) missense probably damaging 1.00
R6093:Cnot1 UTSW 8 96,475,522 (GRCm39) missense probably benign 0.03
R6108:Cnot1 UTSW 8 96,457,048 (GRCm39) missense probably damaging 1.00
R6261:Cnot1 UTSW 8 96,468,549 (GRCm39) missense probably benign 0.00
R6632:Cnot1 UTSW 8 96,499,895 (GRCm39) intron probably benign
R6882:Cnot1 UTSW 8 96,447,054 (GRCm39) missense possibly damaging 0.85
R6966:Cnot1 UTSW 8 96,451,160 (GRCm39) missense probably damaging 1.00
R6985:Cnot1 UTSW 8 96,460,757 (GRCm39) missense probably benign 0.13
R7210:Cnot1 UTSW 8 96,515,286 (GRCm39) missense probably damaging 1.00
R7410:Cnot1 UTSW 8 96,459,787 (GRCm39) missense possibly damaging 0.77
R7623:Cnot1 UTSW 8 96,454,276 (GRCm39) missense probably damaging 1.00
R7624:Cnot1 UTSW 8 96,478,447 (GRCm39) missense probably damaging 1.00
R7695:Cnot1 UTSW 8 96,497,260 (GRCm39) missense probably benign 0.03
R7703:Cnot1 UTSW 8 96,486,726 (GRCm39) critical splice donor site probably null
R7771:Cnot1 UTSW 8 96,491,753 (GRCm39) missense probably damaging 0.99
R7800:Cnot1 UTSW 8 96,491,690 (GRCm39) missense probably benign 0.15
R7809:Cnot1 UTSW 8 96,478,406 (GRCm39) missense probably damaging 1.00
R7857:Cnot1 UTSW 8 96,472,275 (GRCm39) frame shift probably null
R7914:Cnot1 UTSW 8 96,472,275 (GRCm39) frame shift probably null
R7924:Cnot1 UTSW 8 96,472,275 (GRCm39) frame shift probably null
R7926:Cnot1 UTSW 8 96,472,275 (GRCm39) frame shift probably null
R7981:Cnot1 UTSW 8 96,489,797 (GRCm39) missense probably damaging 1.00
R8004:Cnot1 UTSW 8 96,479,380 (GRCm39) missense probably benign 0.03
R8061:Cnot1 UTSW 8 96,491,655 (GRCm39) missense possibly damaging 0.95
R8185:Cnot1 UTSW 8 96,487,979 (GRCm39) missense probably damaging 1.00
R8269:Cnot1 UTSW 8 96,478,389 (GRCm39) missense probably damaging 1.00
R8306:Cnot1 UTSW 8 96,473,649 (GRCm39) missense probably benign 0.05
R8322:Cnot1 UTSW 8 96,496,472 (GRCm39) missense probably benign 0.00
R8427:Cnot1 UTSW 8 96,460,952 (GRCm39) missense probably benign 0.01
R8723:Cnot1 UTSW 8 96,462,907 (GRCm39) missense probably benign 0.00
R8934:Cnot1 UTSW 8 96,491,695 (GRCm39) missense probably benign 0.04
R9025:Cnot1 UTSW 8 96,475,660 (GRCm39) missense probably benign
R9179:Cnot1 UTSW 8 96,500,054 (GRCm39) missense probably benign 0.16
R9280:Cnot1 UTSW 8 96,497,227 (GRCm39) missense probably benign 0.15
R9285:Cnot1 UTSW 8 96,452,746 (GRCm39) missense probably damaging 1.00
R9299:Cnot1 UTSW 8 96,468,448 (GRCm39) missense probably damaging 1.00
R9337:Cnot1 UTSW 8 96,468,448 (GRCm39) missense probably damaging 1.00
R9480:Cnot1 UTSW 8 96,497,338 (GRCm39) missense possibly damaging 0.94
R9548:Cnot1 UTSW 8 96,482,854 (GRCm39) missense probably benign 0.02
R9601:Cnot1 UTSW 8 96,482,835 (GRCm39) missense probably benign 0.02
R9629:Cnot1 UTSW 8 96,455,874 (GRCm39) missense probably damaging 0.98
R9752:Cnot1 UTSW 8 96,488,019 (GRCm39) missense probably damaging 1.00
R9764:Cnot1 UTSW 8 96,496,209 (GRCm39) missense probably benign 0.00
R9789:Cnot1 UTSW 8 96,455,772 (GRCm39) missense probably damaging 1.00
X0050:Cnot1 UTSW 8 96,469,726 (GRCm39) splice site probably null
Z1176:Cnot1 UTSW 8 96,474,905 (GRCm39) missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- ACTGCTTGACATGCTGATCTAAC -3'
(R):5'- AGCTGGGCATTTTAGCAGG -3'

Sequencing Primer
(F):5'- CAAAGATCAGTTGTAACCAATGGC -3'
(R):5'- AGTTTGAGACCAGCCTGATC -3'
Posted On 2014-09-17