Mutagenetix > Incidental Mutations

Incidental Mutation 'R2074:Cnot1'

227434

Institutional Source

Beutler Lab

Gene Symbol

Cnot1

Ensembl Gene

ENSMUSG00000036550

Gene Name

CCR4-NOT transcription complex, subunit 1

Synonyms

6030411K04Rik

MMRRC Submission

040079-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2074 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

95719451-95807464 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 95739833 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Lysine at position 1592 (T1592K)

Ref Sequence

ENSEMBL: ENSMUSP00000148735 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000068452] [ENSMUST00000098473] [ENSMUST00000211887] [ENSMUST00000213006]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000068452
AA Change: T1587K

PolyPhen 2 Score 0.526 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000063565
Gene: ENSMUSG00000036550
AA Change: T1587K

Domain	Start	End	E-Value	Type
low complexity region	181	189	N/A	INTRINSIC
low complexity region	687	698	N/A	INTRINSIC
low complexity region	779	796	N/A	INTRINSIC
PDB:4J8S\|A	798	999	1e-137	PDB
low complexity region	1011	1028	N/A	INTRINSIC
low complexity region	1031	1055	N/A	INTRINSIC
PDB:4CT4\|C	1056	1295	1e-148	PDB
low complexity region	1296	1308	N/A	INTRINSIC
low complexity region	1328	1345	N/A	INTRINSIC
Pfam:DUF3819	1381	1530	2.5e-56	PFAM
low complexity region	1634	1648	N/A	INTRINSIC
Pfam:Not1	1991	2305	2.4e-125	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000098473
AA Change: T1592K

PolyPhen 2 Score 0.175 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000096073
Gene: ENSMUSG00000036550
AA Change: T1592K

Domain	Start	End	E-Value	Type
low complexity region	181	189	N/A	INTRINSIC
Pfam:CNOT1_HEAT	500	656	2.4e-57	PFAM
low complexity region	687	698	N/A	INTRINSIC
low complexity region	779	796	N/A	INTRINSIC
Pfam:CNOT1_TTP_bind	812	1004	1.4e-87	PFAM
low complexity region	1016	1033	N/A	INTRINSIC
low complexity region	1036	1060	N/A	INTRINSIC
Pfam:CNOT1_CAF1_bind	1087	1313	5.7e-99	PFAM
low complexity region	1333	1350	N/A	INTRINSIC
Pfam:DUF3819	1387	1534	2.3e-57	PFAM
low complexity region	1639	1653	N/A	INTRINSIC
Pfam:Not1	1998	2357	5.7e-157	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000211887
AA Change: T1585K

PolyPhen 2 Score 0.677 (Sensitivity: 0.86; Specificity: 0.92)

Predicted Effect

probably benign
Transcript: ENSMUST00000211973

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212195

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212340

Predicted Effect

probably benign
Transcript: ENSMUST00000212415

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212712

Predicted Effect

possibly damaging
Transcript: ENSMUST00000213006
AA Change: T1592K

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice hmozygous for a conditional allele activated in cardiomyocytes exhibit postnatal lethality, decreased cardiac muscle contractility, prolonged QT interval and cardiac muscle cell death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 90 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700022I11Rik	A	T	4: 42,974,171	D1168V	probably benign	Het
4930430A15Rik	T	C	2: 111,200,418	E382G	probably damaging	Het
9130011E15Rik	A	T	19: 45,965,381	I188K	probably damaging	Het
Ace	C	T	11: 105,976,623	Q484*	probably null	Het
Ackr3	T	C	1: 90,213,981	I54T	probably damaging	Het
Aco1	G	A	4: 40,183,605	G508S	probably damaging	Het
Akap8l	C	T	17: 32,332,483	R511H	probably damaging	Het
Ankef1	T	C	2: 136,545,738	S192P	possibly damaging	Het
Ankrd16	T	G	2: 11,789,748	C315G	possibly damaging	Het
Ankzf1	T	C	1: 75,196,243	S328P	probably damaging	Het
Aqp2	A	G	15: 99,583,100	I176V	probably benign	Het
Arhgap45	A	G	10: 80,027,180	Y730C	probably damaging	Het
Asxl2	A	G	12: 3,493,779	E316G	probably damaging	Het
Btbd17	A	T	11: 114,791,952		probably null	Het
Calu	A	G	6: 29,372,615	Y263C	probably damaging	Het
Ccdc122	T	C	14: 77,068,951		probably null	Het
Cenpf	T	C	1: 189,656,901	K1578R	probably damaging	Het
Cep120	A	G	18: 53,719,312	V498A	possibly damaging	Het
Ces1a	T	A	8: 93,048,075	N12Y	probably benign	Het
Chmp1a	A	T	8: 123,208,022	M65K	probably damaging	Het
Cps1	T	A	1: 67,204,638	I1091N	probably benign	Het
Dhx32	T	C	7: 133,721,292	N731S	probably benign	Het
Dhx33	G	A	11: 70,999,843	R177W	probably damaging	Het
Dmd	G	C	X: 84,312,483	A2257P	probably benign	Het
Dnah10	T	C	5: 124,814,674	S3259P	probably damaging	Het
Dnah7a	T	C	1: 53,457,696	I3134V	probably benign	Het
Dock3	A	G	9: 106,993,463	F584S	possibly damaging	Het
Dtnb	A	G	12: 3,781,273	T658A	probably benign	Het
Duox2	T	A	2: 122,295,158	S323C	probably damaging	Het
Elovl3	A	T	19: 46,132,167	E33V	probably damaging	Het
Enpp5	T	C	17: 44,085,373	F392S	probably benign	Het
Eogt	T	C	6: 97,131,376	T235A	probably benign	Het
Etv3	T	C	3: 87,536,219	V370A	probably benign	Het
Ewsr1	C	T	11: 5,071,555	R466H	unknown	Het
Fam208a	T	A	14: 27,461,213	I543K	probably benign	Het
Fcgbp	G	A	7: 28,120,389	G2514S	probably damaging	Het
Flt1	A	T	5: 147,599,606	D808E	possibly damaging	Het
Glg1	C	T	8: 111,168,671	G836E	probably damaging	Het
Gm17334	A	G	11: 53,772,828		probably benign	Het
Gpbp1	A	T	13: 111,453,407	D51E	probably benign	Het
Il12rb2	C	G	6: 67,360,552	C115S	probably damaging	Het
Il1rl1	T	C	1: 40,462,044	S527P	probably damaging	Het
Ireb2	A	G	9: 54,881,449	D69G	probably benign	Het
Kif5a	T	C	10: 127,245,369	D232G	probably damaging	Het
M1ap	A	G	6: 82,981,882	I165V	probably benign	Het
Mff	T	A	1: 82,751,700	L287H	probably damaging	Het
Mmp27	A	G	9: 7,577,739	M311V	possibly damaging	Het
Mpped2	T	A	2: 106,744,802	Y77*	probably null	Het
Mybbp1a	G	A	11: 72,441,445	S21N	probably benign	Het
Obscn	G	C	11: 59,069,281	I3253M	probably damaging	Het
Obscn	T	C	11: 59,132,652	D633G	probably damaging	Het
Olfr1247	A	G	2: 89,609,478	V208A	probably benign	Het
Olfr1404	A	T	1: 173,215,810	D53V	probably damaging	Het
Olr1	C	T	6: 129,502,094	V54I	probably benign	Het
Phlpp2	T	C	8: 109,928,492	S605P	possibly damaging	Het
Plekhg4	TAGTCGATGCCCGAGTC	TAGTC	8: 105,376,452		probably benign	Het
Prss8	C	A	7: 127,927,094	R148L	possibly damaging	Het
Psg27	T	C	7: 18,560,417	D355G	probably damaging	Het
Rabgef1	C	A	5: 130,187,561	Q52K	probably benign	Het
Rnf6	C	T	5: 146,210,906	R434H	probably damaging	Het
Rpl26	A	G	11: 68,903,273	E88G	probably benign	Het
Rpn1	T	A	6: 88,100,962	L460Q	probably damaging	Het
Sap130	T	A	18: 31,648,279	I165N	probably damaging	Het
Sash1	A	G	10: 8,756,697	V258A	probably damaging	Het
Scarb1	G	T	5: 125,294,143	N288K	probably benign	Het
Sec16a	A	G	2: 26,440,239	I588T	probably damaging	Het
Shank2	C	A	7: 144,409,540	S295Y	probably damaging	Het
Slc15a3	T	C	19: 10,857,299	S515P	probably damaging	Het
Slc25a13	A	T	6: 6,114,017	M285K	probably benign	Het
Slc39a11	A	G	11: 113,463,974	I143T	probably null	Het
Smarcd2	A	T	11: 106,265,307	L42*	probably null	Het
Smc3	A	G	19: 53,631,533	D620G	probably benign	Het
Syt10	C	T	15: 89,790,776	D456N	probably damaging	Het
Taar4	A	C	10: 23,961,173	Q227P	probably benign	Het
Tecta	G	T	9: 42,337,279	Y1937*	probably null	Het
Tex10	C	T	4: 48,456,800	R637Q	probably benign	Het
Tmem130	T	A	5: 144,755,274	T107S	possibly damaging	Het
Tmem132d	T	C	5: 128,269,131	D109G	probably damaging	Het
Tmem81	A	G	1: 132,507,906	Y150C	probably damaging	Het
Tnrc18	C	T	5: 142,759,706		probably null	Het
Trim43a	A	G	9: 88,586,094	K256R	possibly damaging	Het
Trpm6	A	G	19: 18,877,739	T1921A	probably damaging	Het
Tubb3	C	T	8: 123,421,270	A314V	probably damaging	Het
Ube3b	A	C	5: 114,415,255	N896T	probably benign	Het
Unc80	G	A	1: 66,679,744		probably null	Het
Upb1	A	G	10: 75,424,513	T134A	probably damaging	Het
Vmn2r15	A	T	5: 109,286,753	M695K	possibly damaging	Het
Wwc1	G	T	11: 35,889,353	D258E	possibly damaging	Het
Zfp619	T	A	7: 39,534,761	Y72N	probably benign	Het
Zfp672	G	T	11: 58,316,636	H286Q	possibly damaging	Het

Other mutations in Cnot1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00516:Cnot1	APN	8	95726079	missense	probably damaging	1.00
IGL01340:Cnot1	APN	8	95760537	missense	probably damaging	1.00
IGL01457:Cnot1	APN	8	95741009	missense	probably damaging	1.00
IGL01505:Cnot1	APN	8	95728718	missense	probably damaging	0.98
IGL02401:Cnot1	APN	8	95756133	missense	possibly damaging	0.95
IGL02693:Cnot1	APN	8	95773485	missense	probably damaging	1.00
IGL02696:Cnot1	APN	8	95745017	missense	probably benign	0.00
IGL02754:Cnot1	APN	8	95755078	missense	probably benign	0.03
IGL03092:Cnot1	APN	8	95769615	intron	probably benign
IGL03174:Cnot1	APN	8	95761355	missense	probably damaging	1.00
IGL03310:Cnot1	APN	8	95735680	splice site	probably benign
IGL03371:Cnot1	APN	8	95774716	missense	possibly damaging	0.85
Affiliate	UTSW	8	95765125	missense	probably damaging	0.99
barge	UTSW	8	95734129	missense	probably benign	0.13
Byproduct	UTSW	8	95745647	frame shift	probably null
Chairman	UTSW	8	95765027	missense	possibly damaging	0.95
cohort	UTSW	8	95735749	missense	probably damaging	0.99
Director	UTSW	8	95765062	missense	probably benign	0.15
kowloon	UTSW	8	95788658	missense	probably damaging	1.00
tugboat	UTSW	8	95773618	missense	probably damaging	0.99
Xiao	UTSW	8	95730420	missense	probably damaging	1.00
BB001:Cnot1	UTSW	8	95745647	frame shift	probably null
BB003:Cnot1	UTSW	8	95745647	frame shift	probably null
BB011:Cnot1	UTSW	8	95745647	frame shift	probably null
BB013:Cnot1	UTSW	8	95745647	frame shift	probably null
R0008:Cnot1	UTSW	8	95761341	missense	probably damaging	1.00
R0008:Cnot1	UTSW	8	95761341	missense	probably damaging	1.00
R0091:Cnot1	UTSW	8	95763144	missense	probably damaging	1.00
R0335:Cnot1	UTSW	8	95772000	missense	probably benign	0.02
R0409:Cnot1	UTSW	8	95748855	missense	probably damaging	0.96
R0445:Cnot1	UTSW	8	95760208	missense	probably damaging	1.00
R1505:Cnot1	UTSW	8	95728667	missense	probably damaging	1.00
R1517:Cnot1	UTSW	8	95743213	missense	probably benign	0.38
R1640:Cnot1	UTSW	8	95769832	missense	probably damaging	0.98
R1737:Cnot1	UTSW	8	95748276	missense	probably damaging	0.98
R1755:Cnot1	UTSW	8	95724577	missense	probably damaging	1.00
R1901:Cnot1	UTSW	8	95743121	missense	possibly damaging	0.50
R1902:Cnot1	UTSW	8	95743121	missense	possibly damaging	0.50
R1903:Cnot1	UTSW	8	95743121	missense	possibly damaging	0.50
R1988:Cnot1	UTSW	8	95741944	missense	possibly damaging	0.89
R2051:Cnot1	UTSW	8	95724593	missense	possibly damaging	0.47
R2054:Cnot1	UTSW	8	95739841	missense	possibly damaging	0.55
R2072:Cnot1	UTSW	8	95739833	missense	possibly damaging	0.89
R2075:Cnot1	UTSW	8	95739833	missense	possibly damaging	0.89
R2093:Cnot1	UTSW	8	95775358	missense	probably damaging	1.00
R2116:Cnot1	UTSW	8	95726153	missense	probably damaging	1.00
R2191:Cnot1	UTSW	8	95761426	missense	probably damaging	0.98
R2238:Cnot1	UTSW	8	95769521	missense	probably benign	0.04
R2239:Cnot1	UTSW	8	95769521	missense	probably benign	0.04
R2251:Cnot1	UTSW	8	95763186	missense	probably benign	0.00
R2252:Cnot1	UTSW	8	95763186	missense	probably benign	0.00
R2253:Cnot1	UTSW	8	95763186	missense	probably benign	0.00
R2315:Cnot1	UTSW	8	95749062	missense	probably damaging	1.00
R2431:Cnot1	UTSW	8	95774652	missense	probably damaging	1.00
R2988:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R2989:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3108:Cnot1	UTSW	8	95735749	missense	probably damaging	0.99
R3109:Cnot1	UTSW	8	95735749	missense	probably damaging	0.99
R3114:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3115:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3153:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3154:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R4112:Cnot1	UTSW	8	95773618	missense	probably damaging	0.99
R4359:Cnot1	UTSW	8	95739848	missense	probably damaging	1.00
R4382:Cnot1	UTSW	8	95769779	missense	probably damaging	0.97
R4747:Cnot1	UTSW	8	95774682	missense	probably benign	0.27
R4910:Cnot1	UTSW	8	95733231	missense	probably benign	0.43
R4913:Cnot1	UTSW	8	95763067	missense	possibly damaging	0.63
R4971:Cnot1	UTSW	8	95721626	missense	probably damaging	1.00
R5056:Cnot1	UTSW	8	95741008	missense	probably damaging	1.00
R5092:Cnot1	UTSW	8	95752768	missense	possibly damaging	0.91
R5101:Cnot1	UTSW	8	95760187	missense	possibly damaging	0.90
R5498:Cnot1	UTSW	8	95757355	missense	possibly damaging	0.92
R5719:Cnot1	UTSW	8	95744296	missense	possibly damaging	0.92
R5850:Cnot1	UTSW	8	95734147	nonsense	probably null
R5956:Cnot1	UTSW	8	95754978	critical splice donor site	probably null
R5981:Cnot1	UTSW	8	95788665	missense	probably damaging	1.00
R6093:Cnot1	UTSW	8	95748894	missense	probably benign	0.03
R6108:Cnot1	UTSW	8	95730420	missense	probably damaging	1.00
R6261:Cnot1	UTSW	8	95741921	missense	probably benign	0.00
R6632:Cnot1	UTSW	8	95773267	intron	probably benign
R6882:Cnot1	UTSW	8	95720426	missense	possibly damaging	0.85
R6966:Cnot1	UTSW	8	95724532	missense	probably damaging	1.00
R6985:Cnot1	UTSW	8	95734129	missense	probably benign	0.13
R7210:Cnot1	UTSW	8	95788658	missense	probably damaging	1.00
R7410:Cnot1	UTSW	8	95733159	missense	possibly damaging	0.77
R7623:Cnot1	UTSW	8	95727648	missense	probably damaging	1.00
R7624:Cnot1	UTSW	8	95751819	missense	probably damaging	1.00
R7695:Cnot1	UTSW	8	95770632	missense	probably benign	0.03
R7703:Cnot1	UTSW	8	95760098	critical splice donor site	probably null
R7771:Cnot1	UTSW	8	95765125	missense	probably damaging	0.99
R7800:Cnot1	UTSW	8	95765062	missense	probably benign	0.15
R7809:Cnot1	UTSW	8	95751778	missense	probably damaging	1.00
R7857:Cnot1	UTSW	8	95745647	frame shift	probably null
R7914:Cnot1	UTSW	8	95745647	frame shift	probably null
R7924:Cnot1	UTSW	8	95745647	frame shift	probably null
R7926:Cnot1	UTSW	8	95745647	frame shift	probably null
R7981:Cnot1	UTSW	8	95763169	missense	probably damaging	1.00
R8004:Cnot1	UTSW	8	95752752	missense	probably benign	0.03
R8061:Cnot1	UTSW	8	95765027	missense	possibly damaging	0.95
R8185:Cnot1	UTSW	8	95761351	missense	probably damaging	1.00
R8269:Cnot1	UTSW	8	95751761	missense	probably damaging	1.00
R8306:Cnot1	UTSW	8	95747021	missense	probably benign	0.05
R8322:Cnot1	UTSW	8	95769844	missense	probably benign	0.00
R8427:Cnot1	UTSW	8	95734324	missense	probably benign	0.01
R8723:Cnot1	UTSW	8	95736279	missense	probably benign	0.00
X0050:Cnot1	UTSW	8	95743098	splice site	probably null
Z1176:Cnot1	UTSW	8	95748277	missense	possibly damaging	0.73

Predicted Primers

PCR Primer
(F):5'- ACTGCTTGACATGCTGATCTAAC -3'
(R):5'- AGCTGGGCATTTTAGCAGG -3'

Sequencing Primer
(F):5'- CAAAGATCAGTTGTAACCAATGGC -3'
(R):5'- AGTTTGAGACCAGCCTGATC -3'

Posted On

2014-09-17