Incidental Mutation 'R2074:Tecta'
ID 227442
Institutional Source Beutler Lab
Gene Symbol Tecta
Ensembl Gene ENSMUSG00000037705
Gene Name tectorin alpha
Synonyms [a]-tectorin, Tctna
MMRRC Submission 040079-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.107) question?
Stock # R2074 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 42240915-42311225 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to T at 42248575 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 1937 (Y1937*)
Ref Sequence ENSEMBL: ENSMUSP00000125370 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042190] [ENSMUST00000160940]
AlphaFold O08523
Predicted Effect probably null
Transcript: ENSMUST00000042190
AA Change: Y1942*
SMART Domains Protein: ENSMUSP00000040262
Gene: ENSMUSG00000037705
AA Change: Y1942*

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
NIDO 98 254 7.88e-77 SMART
VWC 260 314 1.04e0 SMART
VWD 312 477 1.5e-58 SMART
C8 517 592 7.06e-29 SMART
EGF_like 622 645 3.87e1 SMART
VWC 652 713 1.87e-1 SMART
VWD 703 865 4.44e-43 SMART
C8 905 981 9.19e-19 SMART
Pfam:TIL 984 1036 9.8e-13 PFAM
VWD 1090 1257 1.44e-51 SMART
C8 1294 1369 4.64e-15 SMART
EGF_like 1388 1420 5.34e1 SMART
VWC 1427 1487 2.88e-19 SMART
VWD 1477 1638 2.72e-38 SMART
C8 1684 1758 6.51e-10 SMART
ZP 1805 2059 2.95e-85 SMART
EGF 2087 2122 2.07e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159603
Predicted Effect probably null
Transcript: ENSMUST00000160940
AA Change: Y1937*
SMART Domains Protein: ENSMUSP00000125370
Gene: ENSMUSG00000037705
AA Change: Y1937*

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
NIDO 98 254 7.88e-77 SMART
VWC 260 314 1.04e0 SMART
VWD 312 477 1.5e-58 SMART
C8 517 592 7.06e-29 SMART
EGF_like 622 645 3.87e1 SMART
VWC 652 713 1.87e-1 SMART
VWD 703 865 4.44e-43 SMART
C8 905 981 9.19e-19 SMART
Pfam:TIL 984 1036 6.1e-13 PFAM
VWD 1090 1257 1.44e-51 SMART
C8 1294 1369 4.64e-15 SMART
EGF_like 1388 1420 5.34e1 SMART
VWC 1427 1487 2.88e-19 SMART
VWD 1477 1638 2.72e-38 SMART
C8 1679 1753 6.51e-10 SMART
ZP 1800 2054 2.95e-85 SMART
EGF 2082 2117 2.07e1 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The tectorial membrane is an extracellular matrix of the inner ear that contacts the stereocilia bundles of specialized sensory hair cells. Sound induces movement of these hair cells relative to the tectorial membrane, deflects the stereocilia, and leads to fluctuations in hair-cell membrane potential, transducing sound into electrical signals. Alpha-tectorin is one of the major noncollagenous components of the tectorial membrane. Mutations in the TECTA gene have been shown to be responsible for autosomal dominant nonsyndromic hearing impairment and a recessive form of sensorineural pre-lingual non-syndromic deafness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit a tectorial membrane that is detached from the cochlear epithelium. Though the basilar membranes of mutant mice are tuned, sensitivity is attenuated. Mice with an Y1870C mutation have a disrupted tectorial membrane, elevated neural thresholds and broadened neural tuning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace C T 11: 105,867,449 (GRCm39) Q484* probably null Het
Ackr3 T C 1: 90,141,703 (GRCm39) I54T probably damaging Het
Aco1 G A 4: 40,183,605 (GRCm39) G508S probably damaging Het
Akap8l C T 17: 32,551,457 (GRCm39) R511H probably damaging Het
Ankef1 T C 2: 136,387,658 (GRCm39) S192P possibly damaging Het
Ankrd16 T G 2: 11,794,559 (GRCm39) C315G possibly damaging Het
Ankzf1 T C 1: 75,172,887 (GRCm39) S328P probably damaging Het
Aqp2 A G 15: 99,480,981 (GRCm39) I176V probably benign Het
Arhgap45 A G 10: 79,863,014 (GRCm39) Y730C probably damaging Het
Armh3 A T 19: 45,953,820 (GRCm39) I188K probably damaging Het
Asxl2 A G 12: 3,543,779 (GRCm39) E316G probably damaging Het
Btbd17 A T 11: 114,682,778 (GRCm39) probably null Het
Calu A G 6: 29,372,614 (GRCm39) Y263C probably damaging Het
Ccdc122 T C 14: 77,306,391 (GRCm39) probably null Het
Cenpf T C 1: 189,389,098 (GRCm39) K1578R probably damaging Het
Cep120 A G 18: 53,852,384 (GRCm39) V498A possibly damaging Het
Ces1a T A 8: 93,774,703 (GRCm39) N12Y probably benign Het
Chmp1a A T 8: 123,934,761 (GRCm39) M65K probably damaging Het
Cnot1 G T 8: 96,466,461 (GRCm39) T1592K possibly damaging Het
Cps1 T A 1: 67,243,797 (GRCm39) I1091N probably benign Het
Dhx32 T C 7: 133,323,021 (GRCm39) N731S probably benign Het
Dhx33 G A 11: 70,890,669 (GRCm39) R177W probably damaging Het
Dmd G C X: 83,356,089 (GRCm39) A2257P probably benign Het
Dnah10 T C 5: 124,891,738 (GRCm39) S3259P probably damaging Het
Dnah7a T C 1: 53,496,855 (GRCm39) I3134V probably benign Het
Dock3 A G 9: 106,870,662 (GRCm39) F584S possibly damaging Het
Dtnb A G 12: 3,831,273 (GRCm39) T658A probably benign Het
Duox2 T A 2: 122,125,639 (GRCm39) S323C probably damaging Het
Elovl3 A T 19: 46,120,606 (GRCm39) E33V probably damaging Het
Enpp5 T C 17: 44,396,264 (GRCm39) F392S probably benign Het
Eogt T C 6: 97,108,337 (GRCm39) T235A probably benign Het
Etv3 T C 3: 87,443,526 (GRCm39) V370A probably benign Het
Ewsr1 C T 11: 5,021,555 (GRCm39) R466H unknown Het
Fcgbp G A 7: 27,819,814 (GRCm39) G2514S probably damaging Het
Flt1 A T 5: 147,536,416 (GRCm39) D808E possibly damaging Het
Glg1 C T 8: 111,895,303 (GRCm39) G836E probably damaging Het
Gm17334 A G 11: 53,663,654 (GRCm39) probably benign Het
Gpbp1 A T 13: 111,589,941 (GRCm39) D51E probably benign Het
Il12rb2 C G 6: 67,337,536 (GRCm39) C115S probably damaging Het
Il1rl1 T C 1: 40,501,204 (GRCm39) S527P probably damaging Het
Ireb2 A G 9: 54,788,733 (GRCm39) D69G probably benign Het
Kif5a T C 10: 127,081,238 (GRCm39) D232G probably damaging Het
M1ap A G 6: 82,958,863 (GRCm39) I165V probably benign Het
Mff T A 1: 82,729,421 (GRCm39) L287H probably damaging Het
Mmp27 A G 9: 7,577,740 (GRCm39) M311V possibly damaging Het
Mpped2 T A 2: 106,575,147 (GRCm39) Y77* probably null Het
Mybbp1a G A 11: 72,332,271 (GRCm39) S21N probably benign Het
Obscn G C 11: 58,960,107 (GRCm39) I3253M probably damaging Het
Obscn T C 11: 59,023,478 (GRCm39) D633G probably damaging Het
Olr1 C T 6: 129,479,057 (GRCm39) V54I probably benign Het
Or10j3b A T 1: 173,043,377 (GRCm39) D53V probably damaging Het
Or4a74 A G 2: 89,439,822 (GRCm39) V208A probably benign Het
Phlpp2 T C 8: 110,655,124 (GRCm39) S605P possibly damaging Het
Plekhg4 TAGTCGATGCCCGAGTC TAGTC 8: 106,103,084 (GRCm39) probably benign Het
Potefam1 T C 2: 111,030,763 (GRCm39) E382G probably damaging Het
Prss8 C A 7: 127,526,266 (GRCm39) R148L possibly damaging Het
Psg27 T C 7: 18,294,342 (GRCm39) D355G probably damaging Het
Rabgef1 C A 5: 130,216,402 (GRCm39) Q52K probably benign Het
Rnf6 C T 5: 146,147,716 (GRCm39) R434H probably damaging Het
Rpl26 A G 11: 68,794,099 (GRCm39) E88G probably benign Het
Rpn1 T A 6: 88,077,944 (GRCm39) L460Q probably damaging Het
Sap130 T A 18: 31,781,332 (GRCm39) I165N probably damaging Het
Sash1 A G 10: 8,632,461 (GRCm39) V258A probably damaging Het
Scarb1 G T 5: 125,371,207 (GRCm39) N288K probably benign Het
Sec16a A G 2: 26,330,251 (GRCm39) I588T probably damaging Het
Shank2 C A 7: 143,963,277 (GRCm39) S295Y probably damaging Het
Slc15a3 T C 19: 10,834,663 (GRCm39) S515P probably damaging Het
Slc25a13 A T 6: 6,114,017 (GRCm39) M285K probably benign Het
Slc39a11 A G 11: 113,354,800 (GRCm39) I143T probably null Het
Smarcd2 A T 11: 106,156,133 (GRCm39) L42* probably null Het
Smc3 A G 19: 53,619,964 (GRCm39) D620G probably benign Het
Spata31g1 A T 4: 42,974,171 (GRCm39) D1168V probably benign Het
Syt10 C T 15: 89,674,979 (GRCm39) D456N probably damaging Het
Taar4 A C 10: 23,837,071 (GRCm39) Q227P probably benign Het
Tasor T A 14: 27,183,170 (GRCm39) I543K probably benign Het
Tex10 C T 4: 48,456,800 (GRCm39) R637Q probably benign Het
Tmem130 T A 5: 144,692,084 (GRCm39) T107S possibly damaging Het
Tmem132d T C 5: 128,346,195 (GRCm39) D109G probably damaging Het
Tmem81 A G 1: 132,435,644 (GRCm39) Y150C probably damaging Het
Tnrc18 C T 5: 142,745,461 (GRCm39) probably null Het
Trim43a A G 9: 88,468,147 (GRCm39) K256R possibly damaging Het
Trpm6 A G 19: 18,855,103 (GRCm39) T1921A probably damaging Het
Tubb3 C T 8: 124,148,009 (GRCm39) A314V probably damaging Het
Ube3b A C 5: 114,553,316 (GRCm39) N896T probably benign Het
Unc80 G A 1: 66,718,903 (GRCm39) probably null Het
Upb1 A G 10: 75,260,347 (GRCm39) T134A probably damaging Het
Vmn2r15 A T 5: 109,434,619 (GRCm39) M695K possibly damaging Het
Wwc1 G T 11: 35,780,180 (GRCm39) D258E possibly damaging Het
Zfp619 T A 7: 39,184,185 (GRCm39) Y72N probably benign Het
Zfp672 G T 11: 58,207,462 (GRCm39) H286Q possibly damaging Het
Other mutations in Tecta
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Tecta APN 9 42,243,844 (GRCm39) missense probably damaging 1.00
IGL00925:Tecta APN 9 42,286,331 (GRCm39) missense probably benign
IGL00960:Tecta APN 9 42,270,376 (GRCm39) missense possibly damaging 0.74
IGL00974:Tecta APN 9 42,242,670 (GRCm39) missense probably benign 0.00
IGL01070:Tecta APN 9 42,306,299 (GRCm39) missense probably damaging 1.00
IGL01284:Tecta APN 9 42,256,916 (GRCm39) missense probably damaging 1.00
IGL01324:Tecta APN 9 42,256,727 (GRCm39) missense probably damaging 1.00
IGL01694:Tecta APN 9 42,278,475 (GRCm39) missense possibly damaging 0.92
IGL01861:Tecta APN 9 42,284,658 (GRCm39) missense probably benign
IGL02010:Tecta APN 9 42,248,489 (GRCm39) missense probably damaging 0.97
IGL02397:Tecta APN 9 42,306,294 (GRCm39) missense probably damaging 1.00
IGL03031:Tecta APN 9 42,256,789 (GRCm39) missense probably benign
IGL03208:Tecta APN 9 42,248,396 (GRCm39) splice site probably benign
IGL03249:Tecta APN 9 42,303,182 (GRCm39) missense probably benign 0.20
cover UTSW 9 42,255,183 (GRCm39) missense probably benign 0.05
lid UTSW 9 42,284,406 (GRCm39) missense probably damaging 0.99
R0004:Tecta UTSW 9 42,256,774 (GRCm39) missense possibly damaging 0.74
R0045:Tecta UTSW 9 42,286,487 (GRCm39) missense probably damaging 1.00
R0045:Tecta UTSW 9 42,286,487 (GRCm39) missense probably damaging 1.00
R0119:Tecta UTSW 9 42,263,359 (GRCm39) missense probably damaging 1.00
R0133:Tecta UTSW 9 42,278,524 (GRCm39) missense probably benign 0.00
R0157:Tecta UTSW 9 42,286,307 (GRCm39) missense probably benign
R0180:Tecta UTSW 9 42,278,109 (GRCm39) missense probably benign
R0299:Tecta UTSW 9 42,263,359 (GRCm39) missense probably damaging 1.00
R0345:Tecta UTSW 9 42,295,514 (GRCm39) missense probably damaging 0.98
R0370:Tecta UTSW 9 42,278,100 (GRCm39) missense probably benign
R0465:Tecta UTSW 9 42,270,714 (GRCm39) missense possibly damaging 0.62
R0466:Tecta UTSW 9 42,284,369 (GRCm39) missense probably benign
R0479:Tecta UTSW 9 42,249,235 (GRCm39) missense probably damaging 1.00
R0498:Tecta UTSW 9 42,288,910 (GRCm39) missense probably damaging 1.00
R0499:Tecta UTSW 9 42,263,359 (GRCm39) missense probably damaging 1.00
R0519:Tecta UTSW 9 42,259,188 (GRCm39) splice site probably benign
R0584:Tecta UTSW 9 42,259,204 (GRCm39) missense possibly damaging 0.79
R0589:Tecta UTSW 9 42,256,930 (GRCm39) missense probably benign 0.01
R0607:Tecta UTSW 9 42,299,501 (GRCm39) missense probably damaging 1.00
R0691:Tecta UTSW 9 42,295,637 (GRCm39) missense probably damaging 1.00
R0905:Tecta UTSW 9 42,250,290 (GRCm39) missense probably damaging 1.00
R1216:Tecta UTSW 9 42,289,203 (GRCm39) missense probably benign 0.44
R1239:Tecta UTSW 9 42,243,781 (GRCm39) missense probably damaging 1.00
R1442:Tecta UTSW 9 42,243,778 (GRCm39) missense probably damaging 1.00
R1553:Tecta UTSW 9 42,259,482 (GRCm39) missense probably damaging 1.00
R1727:Tecta UTSW 9 42,270,597 (GRCm39) missense probably damaging 0.96
R1728:Tecta UTSW 9 42,303,218 (GRCm39) missense probably benign 0.12
R1729:Tecta UTSW 9 42,303,218 (GRCm39) missense probably benign 0.12
R1762:Tecta UTSW 9 42,286,605 (GRCm39) missense probably benign 0.30
R1778:Tecta UTSW 9 42,254,927 (GRCm39) missense probably damaging 1.00
R1795:Tecta UTSW 9 42,289,345 (GRCm39) missense probably benign
R1796:Tecta UTSW 9 42,295,493 (GRCm39) missense probably damaging 1.00
R1866:Tecta UTSW 9 42,303,320 (GRCm39) missense probably damaging 0.97
R1871:Tecta UTSW 9 42,248,636 (GRCm39) missense probably damaging 1.00
R1871:Tecta UTSW 9 42,248,472 (GRCm39) missense probably damaging 0.98
R1911:Tecta UTSW 9 42,249,232 (GRCm39) missense probably damaging 1.00
R2135:Tecta UTSW 9 42,251,581 (GRCm39) missense probably damaging 1.00
R2171:Tecta UTSW 9 42,270,220 (GRCm39) missense probably damaging 0.99
R2220:Tecta UTSW 9 42,303,326 (GRCm39) missense probably damaging 1.00
R2372:Tecta UTSW 9 42,299,570 (GRCm39) missense probably damaging 1.00
R2570:Tecta UTSW 9 42,243,848 (GRCm39) missense probably damaging 1.00
R2939:Tecta UTSW 9 42,289,290 (GRCm39) missense possibly damaging 0.63
R2940:Tecta UTSW 9 42,289,290 (GRCm39) missense possibly damaging 0.63
R3081:Tecta UTSW 9 42,289,290 (GRCm39) missense possibly damaging 0.63
R3407:Tecta UTSW 9 42,249,150 (GRCm39) missense probably damaging 1.00
R3732:Tecta UTSW 9 42,303,402 (GRCm39) missense possibly damaging 0.95
R3771:Tecta UTSW 9 42,242,292 (GRCm39) missense probably damaging 1.00
R3772:Tecta UTSW 9 42,242,292 (GRCm39) missense probably damaging 1.00
R3773:Tecta UTSW 9 42,242,292 (GRCm39) missense probably damaging 1.00
R3832:Tecta UTSW 9 42,250,329 (GRCm39) missense probably damaging 1.00
R4378:Tecta UTSW 9 42,278,004 (GRCm39) missense probably damaging 1.00
R4480:Tecta UTSW 9 42,284,529 (GRCm39) missense possibly damaging 0.75
R4485:Tecta UTSW 9 42,248,570 (GRCm39) missense possibly damaging 0.73
R4804:Tecta UTSW 9 42,309,533 (GRCm39) missense probably benign
R4869:Tecta UTSW 9 42,286,830 (GRCm39) missense probably benign 0.02
R4944:Tecta UTSW 9 42,241,573 (GRCm39) missense probably benign 0.05
R5008:Tecta UTSW 9 42,284,358 (GRCm39) missense possibly damaging 0.76
R5014:Tecta UTSW 9 42,284,538 (GRCm39) missense probably damaging 1.00
R5125:Tecta UTSW 9 42,286,481 (GRCm39) missense probably damaging 1.00
R5178:Tecta UTSW 9 42,286,481 (GRCm39) missense probably damaging 1.00
R5180:Tecta UTSW 9 42,248,504 (GRCm39) missense probably damaging 1.00
R5214:Tecta UTSW 9 42,256,964 (GRCm39) missense probably benign 0.04
R5230:Tecta UTSW 9 42,306,239 (GRCm39) missense probably damaging 0.96
R5330:Tecta UTSW 9 42,249,152 (GRCm39) missense probably damaging 1.00
R5387:Tecta UTSW 9 42,286,359 (GRCm39) missense probably damaging 0.98
R5614:Tecta UTSW 9 42,250,351 (GRCm39) missense probably damaging 1.00
R5708:Tecta UTSW 9 42,250,222 (GRCm39) missense probably damaging 1.00
R5738:Tecta UTSW 9 42,284,474 (GRCm39) missense possibly damaging 0.63
R5770:Tecta UTSW 9 42,256,885 (GRCm39) missense possibly damaging 0.94
R5839:Tecta UTSW 9 42,284,272 (GRCm39) missense possibly damaging 0.86
R5839:Tecta UTSW 9 42,242,319 (GRCm39) missense probably benign 0.03
R6119:Tecta UTSW 9 42,284,371 (GRCm39) missense probably benign 0.00
R6246:Tecta UTSW 9 42,289,204 (GRCm39) missense probably benign 0.07
R6377:Tecta UTSW 9 42,255,051 (GRCm39) missense probably damaging 1.00
R6416:Tecta UTSW 9 42,286,563 (GRCm39) missense probably damaging 0.97
R6595:Tecta UTSW 9 42,295,523 (GRCm39) missense probably damaging 1.00
R6850:Tecta UTSW 9 42,255,134 (GRCm39) missense probably benign 0.20
R6859:Tecta UTSW 9 42,303,425 (GRCm39) missense probably damaging 1.00
R6861:Tecta UTSW 9 42,248,633 (GRCm39) missense possibly damaging 0.93
R6939:Tecta UTSW 9 42,259,293 (GRCm39) missense probably damaging 1.00
R6996:Tecta UTSW 9 42,278,082 (GRCm39) missense probably benign
R7069:Tecta UTSW 9 42,306,237 (GRCm39) missense probably benign 0.03
R7104:Tecta UTSW 9 42,278,239 (GRCm39) missense probably benign 0.00
R7129:Tecta UTSW 9 42,259,287 (GRCm39) missense probably damaging 1.00
R7220:Tecta UTSW 9 42,255,183 (GRCm39) missense probably benign 0.05
R7251:Tecta UTSW 9 42,299,048 (GRCm39) missense probably damaging 1.00
R7307:Tecta UTSW 9 42,289,288 (GRCm39) missense probably damaging 1.00
R7343:Tecta UTSW 9 42,248,628 (GRCm39) missense probably damaging 1.00
R7355:Tecta UTSW 9 42,278,438 (GRCm39) nonsense probably null
R7635:Tecta UTSW 9 42,242,283 (GRCm39) missense probably benign 0.11
R7653:Tecta UTSW 9 42,248,532 (GRCm39) missense probably damaging 1.00
R7723:Tecta UTSW 9 42,278,232 (GRCm39) missense probably damaging 1.00
R7939:Tecta UTSW 9 42,299,519 (GRCm39) missense probably damaging 0.99
R7966:Tecta UTSW 9 42,306,258 (GRCm39) missense probably damaging 0.98
R7967:Tecta UTSW 9 42,289,251 (GRCm39) missense possibly damaging 0.95
R8000:Tecta UTSW 9 42,278,480 (GRCm39) nonsense probably null
R8064:Tecta UTSW 9 42,306,251 (GRCm39) missense possibly damaging 0.94
R8117:Tecta UTSW 9 42,288,927 (GRCm39) missense probably damaging 1.00
R8176:Tecta UTSW 9 42,270,465 (GRCm39) missense probably damaging 0.97
R8284:Tecta UTSW 9 42,289,325 (GRCm39) missense possibly damaging 0.89
R8315:Tecta UTSW 9 42,299,121 (GRCm39) critical splice acceptor site probably null
R8321:Tecta UTSW 9 42,284,349 (GRCm39) missense probably damaging 1.00
R8332:Tecta UTSW 9 42,286,310 (GRCm39) missense probably damaging 1.00
R8437:Tecta UTSW 9 42,243,856 (GRCm39) missense probably damaging 0.98
R8496:Tecta UTSW 9 42,241,547 (GRCm39) missense probably benign 0.01
R8514:Tecta UTSW 9 42,284,406 (GRCm39) missense probably damaging 0.99
R8683:Tecta UTSW 9 42,278,268 (GRCm39) missense probably damaging 0.96
R8856:Tecta UTSW 9 42,284,597 (GRCm39) missense probably benign 0.13
R8886:Tecta UTSW 9 42,278,359 (GRCm39) missense probably benign 0.37
R9047:Tecta UTSW 9 42,286,375 (GRCm39) missense probably benign 0.00
R9106:Tecta UTSW 9 42,278,479 (GRCm39) missense probably benign 0.05
R9332:Tecta UTSW 9 42,284,193 (GRCm39) missense probably damaging 1.00
R9352:Tecta UTSW 9 42,249,147 (GRCm39) missense probably damaging 1.00
R9462:Tecta UTSW 9 42,248,576 (GRCm39) missense probably damaging 1.00
R9535:Tecta UTSW 9 42,270,759 (GRCm39) missense probably damaging 0.99
R9564:Tecta UTSW 9 42,249,123 (GRCm39) missense probably damaging 0.97
R9592:Tecta UTSW 9 42,250,238 (GRCm39) missense probably damaging 1.00
R9715:Tecta UTSW 9 42,286,596 (GRCm39) missense probably damaging 1.00
Z1176:Tecta UTSW 9 42,303,390 (GRCm39) missense probably damaging 0.99
Z1177:Tecta UTSW 9 42,286,872 (GRCm39) missense probably benign 0.00
Z1177:Tecta UTSW 9 42,303,366 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCACCCTCCTTCGATGATGAAG -3'
(R):5'- TGAGGACTGCATGCCATGTC -3'

Sequencing Primer
(F):5'- CTCCTTCGATGATGAAGTACCGAAG -3'
(R):5'- GACTGCATGCCATGTCTTCCC -3'
Posted On 2014-09-17