Mutagenetix > Incidental Mutations

Incidental Mutation 'R2074:Kif5a'

227451

Institutional Source

Beutler Lab

Gene Symbol

Kif5a

Ensembl Gene

ENSMUSG00000074657

Gene Name

kinesin family member 5A

Synonyms

Khc, Kns, Kif5, D10Bwg0738e

MMRRC Submission

040079-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2074 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

127225696-127263348 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 127245369 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 232 (D232G)

Ref Sequence

ENSEMBL: ENSMUSP00000151402 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099172] [ENSMUST00000217895] [ENSMUST00000218298]

Predicted Effect

probably damaging
Transcript: ENSMUST00000099172
AA Change: D232G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000096775
Gene: ENSMUSG00000074657
AA Change: D232G

Domain	Start	End	E-Value	Type
KISc	7	335	7.38e-173	SMART
low complexity region	340	362	N/A	INTRINSIC
coiled coil region	408	539	N/A	INTRINSIC
low complexity region	591	603	N/A	INTRINSIC
coiled coil region	632	800	N/A	INTRINSIC
coiled coil region	822	905	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000217895
AA Change: D232G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

Predicted Effect

probably benign
Transcript: ENSMUST00000218298

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kinesin family of proteins. Members of this family are part of a multisubunit complex that functions as a microtubule motor in intracellular organelle transport. Mutations in this gene cause autosomal dominant spastic paraplegia 10. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene causes complete neonatal lethality. Homozygotes delivered by caesarian section are alive at E18.5 but usually die within minutes after birth, exhibiting an abnormal breathing pattern, atelectasis, cyanosis, and abnormal motor neuron morphology in the spinal cord. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 90 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700022I11Rik	A	T	4: 42,974,171	D1168V	probably benign	Het
4930430A15Rik	T	C	2: 111,200,418	E382G	probably damaging	Het
9130011E15Rik	A	T	19: 45,965,381	I188K	probably damaging	Het
Ace	C	T	11: 105,976,623	Q484*	probably null	Het
Ackr3	T	C	1: 90,213,981	I54T	probably damaging	Het
Aco1	G	A	4: 40,183,605	G508S	probably damaging	Het
Akap8l	C	T	17: 32,332,483	R511H	probably damaging	Het
Ankef1	T	C	2: 136,545,738	S192P	possibly damaging	Het
Ankrd16	T	G	2: 11,789,748	C315G	possibly damaging	Het
Ankzf1	T	C	1: 75,196,243	S328P	probably damaging	Het
Aqp2	A	G	15: 99,583,100	I176V	probably benign	Het
Arhgap45	A	G	10: 80,027,180	Y730C	probably damaging	Het
Asxl2	A	G	12: 3,493,779	E316G	probably damaging	Het
Btbd17	A	T	11: 114,791,952		probably null	Het
Calu	A	G	6: 29,372,615	Y263C	probably damaging	Het
Ccdc122	T	C	14: 77,068,951		probably null	Het
Cenpf	T	C	1: 189,656,901	K1578R	probably damaging	Het
Cep120	A	G	18: 53,719,312	V498A	possibly damaging	Het
Ces1a	T	A	8: 93,048,075	N12Y	probably benign	Het
Chmp1a	A	T	8: 123,208,022	M65K	probably damaging	Het
Cnot1	G	T	8: 95,739,833	T1592K	possibly damaging	Het
Cps1	T	A	1: 67,204,638	I1091N	probably benign	Het
Dhx32	T	C	7: 133,721,292	N731S	probably benign	Het
Dhx33	G	A	11: 70,999,843	R177W	probably damaging	Het
Dmd	G	C	X: 84,312,483	A2257P	probably benign	Het
Dnah10	T	C	5: 124,814,674	S3259P	probably damaging	Het
Dnah7a	T	C	1: 53,457,696	I3134V	probably benign	Het
Dock3	A	G	9: 106,993,463	F584S	possibly damaging	Het
Dtnb	A	G	12: 3,781,273	T658A	probably benign	Het
Duox2	T	A	2: 122,295,158	S323C	probably damaging	Het
Elovl3	A	T	19: 46,132,167	E33V	probably damaging	Het
Enpp5	T	C	17: 44,085,373	F392S	probably benign	Het
Eogt	T	C	6: 97,131,376	T235A	probably benign	Het
Etv3	T	C	3: 87,536,219	V370A	probably benign	Het
Ewsr1	C	T	11: 5,071,555	R466H	unknown	Het
Fam208a	T	A	14: 27,461,213	I543K	probably benign	Het
Fcgbp	G	A	7: 28,120,389	G2514S	probably damaging	Het
Flt1	A	T	5: 147,599,606	D808E	possibly damaging	Het
Glg1	C	T	8: 111,168,671	G836E	probably damaging	Het
Gm17334	A	G	11: 53,772,828		probably benign	Het
Gpbp1	A	T	13: 111,453,407	D51E	probably benign	Het
Il12rb2	C	G	6: 67,360,552	C115S	probably damaging	Het
Il1rl1	T	C	1: 40,462,044	S527P	probably damaging	Het
Ireb2	A	G	9: 54,881,449	D69G	probably benign	Het
M1ap	A	G	6: 82,981,882	I165V	probably benign	Het
Mff	T	A	1: 82,751,700	L287H	probably damaging	Het
Mmp27	A	G	9: 7,577,739	M311V	possibly damaging	Het
Mpped2	T	A	2: 106,744,802	Y77*	probably null	Het
Mybbp1a	G	A	11: 72,441,445	S21N	probably benign	Het
Obscn	G	C	11: 59,069,281	I3253M	probably damaging	Het
Obscn	T	C	11: 59,132,652	D633G	probably damaging	Het
Olfr1247	A	G	2: 89,609,478	V208A	probably benign	Het
Olfr1404	A	T	1: 173,215,810	D53V	probably damaging	Het
Olr1	C	T	6: 129,502,094	V54I	probably benign	Het
Phlpp2	T	C	8: 109,928,492	S605P	possibly damaging	Het
Plekhg4	TAGTCGATGCCCGAGTC	TAGTC	8: 105,376,452		probably benign	Het
Prss8	C	A	7: 127,927,094	R148L	possibly damaging	Het
Psg27	T	C	7: 18,560,417	D355G	probably damaging	Het
Rabgef1	C	A	5: 130,187,561	Q52K	probably benign	Het
Rnf6	C	T	5: 146,210,906	R434H	probably damaging	Het
Rpl26	A	G	11: 68,903,273	E88G	probably benign	Het
Rpn1	T	A	6: 88,100,962	L460Q	probably damaging	Het
Sap130	T	A	18: 31,648,279	I165N	probably damaging	Het
Sash1	A	G	10: 8,756,697	V258A	probably damaging	Het
Scarb1	G	T	5: 125,294,143	N288K	probably benign	Het
Sec16a	A	G	2: 26,440,239	I588T	probably damaging	Het
Shank2	C	A	7: 144,409,540	S295Y	probably damaging	Het
Slc15a3	T	C	19: 10,857,299	S515P	probably damaging	Het
Slc25a13	A	T	6: 6,114,017	M285K	probably benign	Het
Slc39a11	A	G	11: 113,463,974	I143T	probably null	Het
Smarcd2	A	T	11: 106,265,307	L42*	probably null	Het
Smc3	A	G	19: 53,631,533	D620G	probably benign	Het
Syt10	C	T	15: 89,790,776	D456N	probably damaging	Het
Taar4	A	C	10: 23,961,173	Q227P	probably benign	Het
Tecta	G	T	9: 42,337,279	Y1937*	probably null	Het
Tex10	C	T	4: 48,456,800	R637Q	probably benign	Het
Tmem130	T	A	5: 144,755,274	T107S	possibly damaging	Het
Tmem132d	T	C	5: 128,269,131	D109G	probably damaging	Het
Tmem81	A	G	1: 132,507,906	Y150C	probably damaging	Het
Tnrc18	C	T	5: 142,759,706		probably null	Het
Trim43a	A	G	9: 88,586,094	K256R	possibly damaging	Het
Trpm6	A	G	19: 18,877,739	T1921A	probably damaging	Het
Tubb3	C	T	8: 123,421,270	A314V	probably damaging	Het
Ube3b	A	C	5: 114,415,255	N896T	probably benign	Het
Unc80	G	A	1: 66,679,744		probably null	Het
Upb1	A	G	10: 75,424,513	T134A	probably damaging	Het
Vmn2r15	A	T	5: 109,286,753	M695K	possibly damaging	Het
Wwc1	G	T	11: 35,889,353	D258E	possibly damaging	Het
Zfp619	T	A	7: 39,534,761	Y72N	probably benign	Het
Zfp672	G	T	11: 58,316,636	H286Q	possibly damaging	Het

Other mutations in Kif5a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01011:Kif5a	APN	10	127239196	missense	probably benign
IGL01405:Kif5a	APN	10	127245990	missense	probably damaging	1.00
IGL01637:Kif5a	APN	10	127245368	missense	possibly damaging	0.94
IGL01894:Kif5a	APN	10	127262779	missense	probably benign	0.04
IGL01978:Kif5a	APN	10	127245739	missense	probably benign
IGL02039:Kif5a	APN	10	127233867	missense	possibly damaging	0.95
IGL02052:Kif5a	APN	10	127243499	missense	probably damaging	1.00
IGL02336:Kif5a	APN	10	127242696	missense	possibly damaging	0.87
IGL02352:Kif5a	APN	10	127243501	missense	probably damaging	1.00
IGL02359:Kif5a	APN	10	127243501	missense	probably damaging	1.00
IGL02834:Kif5a	APN	10	127245756	missense	probably benign	0.00
IGL03101:Kif5a	APN	10	127235609	unclassified	probably benign
brittany	UTSW	10	127248254	missense	probably damaging	1.00
spaniel	UTSW	10	127230578	missense	probably benign	0.00
R0463:Kif5a	UTSW	10	127235652	missense	probably benign	0.00
R0790:Kif5a	UTSW	10	127246009	intron	probably benign
R1070:Kif5a	UTSW	10	127245406	missense	probably benign	0.00
R1404:Kif5a	UTSW	10	127245442	missense	probably benign	0.12
R1404:Kif5a	UTSW	10	127245442	missense	probably benign	0.12
R1502:Kif5a	UTSW	10	127245441	missense	probably damaging	1.00
R1812:Kif5a	UTSW	10	127242010	missense	probably benign	0.03
R1837:Kif5a	UTSW	10	127236815	nonsense	probably null
R1838:Kif5a	UTSW	10	127236815	nonsense	probably null
R2012:Kif5a	UTSW	10	127239175	missense	probably benign
R2072:Kif5a	UTSW	10	127245369	missense	probably damaging	0.99
R2073:Kif5a	UTSW	10	127245369	missense	probably damaging	0.99
R2075:Kif5a	UTSW	10	127245369	missense	probably damaging	0.99
R2440:Kif5a	UTSW	10	127231336	missense	probably benign	0.34
R3157:Kif5a	UTSW	10	127245441	missense	probably damaging	1.00
R3688:Kif5a	UTSW	10	127242774	missense	probably damaging	1.00
R3740:Kif5a	UTSW	10	127243468	missense	probably damaging	1.00
R4782:Kif5a	UTSW	10	127230954	missense	probably benign	0.01
R5049:Kif5a	UTSW	10	127239839	missense	possibly damaging	0.93
R5723:Kif5a	UTSW	10	127231029	frame shift	probably null
R5764:Kif5a	UTSW	10	127231029	frame shift	probably null
R5838:Kif5a	UTSW	10	127245441	missense	probably damaging	1.00
R5903:Kif5a	UTSW	10	127230578	missense	probably benign	0.00
R6299:Kif5a	UTSW	10	127233821	missense	probably damaging	1.00
R6384:Kif5a	UTSW	10	127242775	missense	probably damaging	1.00
R6629:Kif5a	UTSW	10	127248254	missense	probably damaging	1.00
R7463:Kif5a	UTSW	10	127243724	missense	probably damaging	0.97
R7558:Kif5a	UTSW	10	127248079	missense	probably damaging	1.00
R7567:Kif5a	UTSW	10	127237379	missense	probably benign	0.00
R7733:Kif5a	UTSW	10	127236740	missense	probably benign	0.00
R7853:Kif5a	UTSW	10	127235668	nonsense	probably null
R7869:Kif5a	UTSW	10	127243474	missense	probably damaging	1.00
R7896:Kif5a	UTSW	10	127242004	missense	probably benign
R8085:Kif5a	UTSW	10	127239309	missense	probably benign	0.00
R8426:Kif5a	UTSW	10	127231489	missense	probably damaging	0.99
Z1177:Kif5a	UTSW	10	127229823	missense	probably benign	0.00
Z1177:Kif5a	UTSW	10	127236967	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AAATATTTGCTTATTACTGGGGAGGGC -3'
(R):5'- AACCGTCACGTAGCTGTCAC -3'

Sequencing Primer
(F):5'- ACTGGGGAGGGCTTGTAATATTATC -3'
(R):5'- TCACGTAGCTGTCACCAGTAAGTG -3'

Posted On

2014-09-17