Incidental Mutation 'R2074:Trpm6'
ID 227482
Institutional Source Beutler Lab
Gene Symbol Trpm6
Ensembl Gene ENSMUSG00000024727
Gene Name transient receptor potential cation channel, subfamily M, member 6
Synonyms CHAK2
MMRRC Submission 040079-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2074 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 18749983-18892510 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 18877739 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 1921 (T1921A)
Ref Sequence ENSEMBL: ENSMUSP00000037443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040489]
AlphaFold Q8CIR4
Predicted Effect probably damaging
Transcript: ENSMUST00000040489
AA Change: T1921A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000037443
Gene: ENSMUSG00000024727
AA Change: T1921A

DomainStartEndE-ValueType
Blast:ANK 430 459 4e-8 BLAST
low complexity region 580 604 N/A INTRINSIC
transmembrane domain 749 766 N/A INTRINSIC
Pfam:Ion_trans 847 1087 2.8e-13 PFAM
low complexity region 1113 1126 N/A INTRINSIC
low complexity region 1136 1154 N/A INTRINSIC
Pfam:TRPM_tetra 1176 1231 7.5e-27 PFAM
low complexity region 1320 1331 N/A INTRINSIC
low complexity region 1578 1596 N/A INTRINSIC
Blast:Alpha_kinase 1618 1673 9e-11 BLAST
low complexity region 1682 1695 N/A INTRINSIC
Alpha_kinase 1761 1978 1e-84 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is predominantly expressed in the kidney and colon, and encodes a protein containing an ion channel domain and a protein kinase domain. It is crucial for magnesium homeostasis, and plays an essential role in epithelial magnesium transport and in the active magnesium absorption in the gut and kidney. Mutations in this gene are associated with hypomagnesemia with secondary hypocalcemia. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic and postnatal lethality with exencephaly, spina bifida occulta, and abnormal brain and facial development. Mice heterozygous for a knock-out allele exhibit some premature death and decreased serummagnesium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A T 4: 42,974,171 D1168V probably benign Het
4930430A15Rik T C 2: 111,200,418 E382G probably damaging Het
9130011E15Rik A T 19: 45,965,381 I188K probably damaging Het
Ace C T 11: 105,976,623 Q484* probably null Het
Ackr3 T C 1: 90,213,981 I54T probably damaging Het
Aco1 G A 4: 40,183,605 G508S probably damaging Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Ankef1 T C 2: 136,545,738 S192P possibly damaging Het
Ankrd16 T G 2: 11,789,748 C315G possibly damaging Het
Ankzf1 T C 1: 75,196,243 S328P probably damaging Het
Aqp2 A G 15: 99,583,100 I176V probably benign Het
Arhgap45 A G 10: 80,027,180 Y730C probably damaging Het
Asxl2 A G 12: 3,493,779 E316G probably damaging Het
Btbd17 A T 11: 114,791,952 probably null Het
Calu A G 6: 29,372,615 Y263C probably damaging Het
Ccdc122 T C 14: 77,068,951 probably null Het
Cenpf T C 1: 189,656,901 K1578R probably damaging Het
Cep120 A G 18: 53,719,312 V498A possibly damaging Het
Ces1a T A 8: 93,048,075 N12Y probably benign Het
Chmp1a A T 8: 123,208,022 M65K probably damaging Het
Cnot1 G T 8: 95,739,833 T1592K possibly damaging Het
Cps1 T A 1: 67,204,638 I1091N probably benign Het
Dhx32 T C 7: 133,721,292 N731S probably benign Het
Dhx33 G A 11: 70,999,843 R177W probably damaging Het
Dmd G C X: 84,312,483 A2257P probably benign Het
Dnah10 T C 5: 124,814,674 S3259P probably damaging Het
Dnah7a T C 1: 53,457,696 I3134V probably benign Het
Dock3 A G 9: 106,993,463 F584S possibly damaging Het
Dtnb A G 12: 3,781,273 T658A probably benign Het
Duox2 T A 2: 122,295,158 S323C probably damaging Het
Elovl3 A T 19: 46,132,167 E33V probably damaging Het
Enpp5 T C 17: 44,085,373 F392S probably benign Het
Eogt T C 6: 97,131,376 T235A probably benign Het
Etv3 T C 3: 87,536,219 V370A probably benign Het
Ewsr1 C T 11: 5,071,555 R466H unknown Het
Fam208a T A 14: 27,461,213 I543K probably benign Het
Fcgbp G A 7: 28,120,389 G2514S probably damaging Het
Flt1 A T 5: 147,599,606 D808E possibly damaging Het
Glg1 C T 8: 111,168,671 G836E probably damaging Het
Gm17334 A G 11: 53,772,828 probably benign Het
Gpbp1 A T 13: 111,453,407 D51E probably benign Het
Il12rb2 C G 6: 67,360,552 C115S probably damaging Het
Il1rl1 T C 1: 40,462,044 S527P probably damaging Het
Ireb2 A G 9: 54,881,449 D69G probably benign Het
Kif5a T C 10: 127,245,369 D232G probably damaging Het
M1ap A G 6: 82,981,882 I165V probably benign Het
Mff T A 1: 82,751,700 L287H probably damaging Het
Mmp27 A G 9: 7,577,739 M311V possibly damaging Het
Mpped2 T A 2: 106,744,802 Y77* probably null Het
Mybbp1a G A 11: 72,441,445 S21N probably benign Het
Obscn G C 11: 59,069,281 I3253M probably damaging Het
Obscn T C 11: 59,132,652 D633G probably damaging Het
Olfr1247 A G 2: 89,609,478 V208A probably benign Het
Olfr1404 A T 1: 173,215,810 D53V probably damaging Het
Olr1 C T 6: 129,502,094 V54I probably benign Het
Phlpp2 T C 8: 109,928,492 S605P possibly damaging Het
Plekhg4 TAGTCGATGCCCGAGTC TAGTC 8: 105,376,452 probably benign Het
Prss8 C A 7: 127,927,094 R148L possibly damaging Het
Psg27 T C 7: 18,560,417 D355G probably damaging Het
Rabgef1 C A 5: 130,187,561 Q52K probably benign Het
Rnf6 C T 5: 146,210,906 R434H probably damaging Het
Rpl26 A G 11: 68,903,273 E88G probably benign Het
Rpn1 T A 6: 88,100,962 L460Q probably damaging Het
Sap130 T A 18: 31,648,279 I165N probably damaging Het
Sash1 A G 10: 8,756,697 V258A probably damaging Het
Scarb1 G T 5: 125,294,143 N288K probably benign Het
Sec16a A G 2: 26,440,239 I588T probably damaging Het
Shank2 C A 7: 144,409,540 S295Y probably damaging Het
Slc15a3 T C 19: 10,857,299 S515P probably damaging Het
Slc25a13 A T 6: 6,114,017 M285K probably benign Het
Slc39a11 A G 11: 113,463,974 I143T probably null Het
Smarcd2 A T 11: 106,265,307 L42* probably null Het
Smc3 A G 19: 53,631,533 D620G probably benign Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Taar4 A C 10: 23,961,173 Q227P probably benign Het
Tecta G T 9: 42,337,279 Y1937* probably null Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tmem130 T A 5: 144,755,274 T107S possibly damaging Het
Tmem132d T C 5: 128,269,131 D109G probably damaging Het
Tmem81 A G 1: 132,507,906 Y150C probably damaging Het
Tnrc18 C T 5: 142,759,706 probably null Het
Trim43a A G 9: 88,586,094 K256R possibly damaging Het
Tubb3 C T 8: 123,421,270 A314V probably damaging Het
Ube3b A C 5: 114,415,255 N896T probably benign Het
Unc80 G A 1: 66,679,744 probably null Het
Upb1 A G 10: 75,424,513 T134A probably damaging Het
Vmn2r15 A T 5: 109,286,753 M695K possibly damaging Het
Wwc1 G T 11: 35,889,353 D258E possibly damaging Het
Zfp619 T A 7: 39,534,761 Y72N probably benign Het
Zfp672 G T 11: 58,316,636 H286Q possibly damaging Het
Other mutations in Trpm6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Trpm6 APN 19 18783908 splice site probably benign
IGL00862:Trpm6 APN 19 18827528 missense probably damaging 1.00
IGL01348:Trpm6 APN 19 18877651 missense probably damaging 1.00
IGL01400:Trpm6 APN 19 18825794 nonsense probably null
IGL01451:Trpm6 APN 19 18809569 missense probably damaging 1.00
IGL01508:Trpm6 APN 19 18796530 nonsense probably null
IGL01995:Trpm6 APN 19 18830327 splice site probably benign
IGL02092:Trpm6 APN 19 18772331 missense possibly damaging 0.59
IGL02152:Trpm6 APN 19 18832539 missense possibly damaging 0.93
IGL02294:Trpm6 APN 19 18854063 missense probably benign
IGL02329:Trpm6 APN 19 18854217 missense probably benign 0.17
IGL02366:Trpm6 APN 19 18778510 splice site probably benign
IGL02402:Trpm6 APN 19 18786756 missense probably benign 0.18
IGL02457:Trpm6 APN 19 18827398 nonsense probably null
IGL02457:Trpm6 APN 19 18825791 missense probably damaging 1.00
IGL02684:Trpm6 APN 19 18802207 splice site probably benign
IGL02705:Trpm6 APN 19 18776733 critical splice donor site probably null
IGL02728:Trpm6 APN 19 18809652 missense possibly damaging 0.71
IGL02742:Trpm6 APN 19 18830012 splice site probably benign
IGL02818:Trpm6 APN 19 18866257 missense probably benign 0.04
IGL02836:Trpm6 APN 19 18813482 missense probably damaging 1.00
IGL03119:Trpm6 APN 19 18838017 nonsense probably null
IGL03193:Trpm6 APN 19 18825872 missense possibly damaging 0.94
IGL03227:Trpm6 APN 19 18819119 missense probably benign 0.01
IGL03227:Trpm6 APN 19 18786779 missense probably benign 0.12
IGL03231:Trpm6 APN 19 18819181 missense probably benign
IGL03245:Trpm6 APN 19 18877701 missense probably damaging 1.00
IGL03328:Trpm6 APN 19 18838082 missense possibly damaging 0.94
IGL03341:Trpm6 APN 19 18813486 missense probably benign
P0043:Trpm6 UTSW 19 18877765 missense probably damaging 1.00
PIT4260001:Trpm6 UTSW 19 18825802 missense possibly damaging 0.48
R0057:Trpm6 UTSW 19 18786755 missense probably benign 0.05
R0115:Trpm6 UTSW 19 18829952 missense probably damaging 0.98
R0119:Trpm6 UTSW 19 18832593 missense probably benign 0.05
R0140:Trpm6 UTSW 19 18819194 splice site probably null
R0267:Trpm6 UTSW 19 18823378 missense probably benign
R0350:Trpm6 UTSW 19 18883957 splice site probably null
R0373:Trpm6 UTSW 19 18853587 missense probably benign 0.15
R0393:Trpm6 UTSW 19 18778644 missense probably damaging 0.99
R0416:Trpm6 UTSW 19 18783025 splice site probably benign
R0505:Trpm6 UTSW 19 18873902 splice site probably benign
R0526:Trpm6 UTSW 19 18792876 missense probably damaging 0.97
R0607:Trpm6 UTSW 19 18872221 missense probably benign 0.00
R0609:Trpm6 UTSW 19 18825862 missense probably damaging 0.97
R0714:Trpm6 UTSW 19 18838087 missense possibly damaging 0.90
R1215:Trpm6 UTSW 19 18796498 missense probably damaging 1.00
R1474:Trpm6 UTSW 19 18796495 missense probably benign 0.28
R1512:Trpm6 UTSW 19 18875931 missense probably benign
R1558:Trpm6 UTSW 19 18786828 missense probably benign 0.04
R1597:Trpm6 UTSW 19 18827524 missense probably damaging 0.98
R1618:Trpm6 UTSW 19 18877631 missense possibly damaging 0.88
R1779:Trpm6 UTSW 19 18856217 missense probably damaging 1.00
R1796:Trpm6 UTSW 19 18827567 missense possibly damaging 0.90
R1799:Trpm6 UTSW 19 18891999 splice site probably null
R1840:Trpm6 UTSW 19 18866267 missense probably benign 0.21
R1991:Trpm6 UTSW 19 18796284 missense probably benign 0.00
R2030:Trpm6 UTSW 19 18854265 missense probably benign
R2073:Trpm6 UTSW 19 18876042 missense probably damaging 1.00
R2096:Trpm6 UTSW 19 18825752 missense probably damaging 0.97
R2103:Trpm6 UTSW 19 18796284 missense probably benign 0.00
R2106:Trpm6 UTSW 19 18813350 missense possibly damaging 0.95
R2117:Trpm6 UTSW 19 18829952 missense probably damaging 0.98
R2850:Trpm6 UTSW 19 18792090 missense possibly damaging 0.68
R3125:Trpm6 UTSW 19 18854431 missense probably benign 0.05
R3719:Trpm6 UTSW 19 18772393 nonsense probably null
R3779:Trpm6 UTSW 19 18876039 missense possibly damaging 0.80
R4115:Trpm6 UTSW 19 18832557 missense probably damaging 1.00
R4367:Trpm6 UTSW 19 18827525 missense probably damaging 0.99
R4523:Trpm6 UTSW 19 18796500 missense probably damaging 1.00
R4546:Trpm6 UTSW 19 18832477 missense probably damaging 1.00
R4564:Trpm6 UTSW 19 18832597 missense possibly damaging 0.95
R4565:Trpm6 UTSW 19 18825872 missense probably damaging 1.00
R4697:Trpm6 UTSW 19 18853791 missense probably benign 0.01
R4714:Trpm6 UTSW 19 18854200 missense possibly damaging 0.93
R4750:Trpm6 UTSW 19 18876064 missense probably damaging 0.99
R4771:Trpm6 UTSW 19 18813493 missense probably damaging 0.97
R4791:Trpm6 UTSW 19 18867981 missense probably benign 0.00
R4814:Trpm6 UTSW 19 18862212 missense probably benign 0.11
R5028:Trpm6 UTSW 19 18786760 missense probably damaging 1.00
R5237:Trpm6 UTSW 19 18813464 missense probably damaging 1.00
R5615:Trpm6 UTSW 19 18829933 missense probably damaging 0.96
R5642:Trpm6 UTSW 19 18830207 missense probably damaging 1.00
R5645:Trpm6 UTSW 19 18853604 missense probably damaging 1.00
R5726:Trpm6 UTSW 19 18853617 missense probably damaging 1.00
R5832:Trpm6 UTSW 19 18786819 missense possibly damaging 0.66
R5843:Trpm6 UTSW 19 18856175 missense probably benign 0.04
R5955:Trpm6 UTSW 19 18892019 missense possibly damaging 0.75
R6101:Trpm6 UTSW 19 18853748 nonsense probably null
R6105:Trpm6 UTSW 19 18853748 nonsense probably null
R6211:Trpm6 UTSW 19 18783128 missense probably damaging 1.00
R6228:Trpm6 UTSW 19 18854291 missense probably damaging 1.00
R6263:Trpm6 UTSW 19 18854108 missense possibly damaging 0.94
R6453:Trpm6 UTSW 19 18829990 missense probably damaging 1.00
R6562:Trpm6 UTSW 19 18838042 missense probably damaging 1.00
R6624:Trpm6 UTSW 19 18796439 critical splice acceptor site probably null
R6624:Trpm6 UTSW 19 18889020 missense probably damaging 1.00
R6729:Trpm6 UTSW 19 18830297 missense probably damaging 1.00
R6765:Trpm6 UTSW 19 18877765 missense probably damaging 1.00
R6976:Trpm6 UTSW 19 18783163 missense probably benign
R7103:Trpm6 UTSW 19 18813547 missense possibly damaging 0.87
R7126:Trpm6 UTSW 19 18854033 nonsense probably null
R7128:Trpm6 UTSW 19 18811773 missense possibly damaging 0.92
R7157:Trpm6 UTSW 19 18838098 missense possibly damaging 0.91
R7212:Trpm6 UTSW 19 18853791 missense probably benign 0.01
R7263:Trpm6 UTSW 19 18876786 missense probably damaging 1.00
R7268:Trpm6 UTSW 19 18778585 missense probably benign 0.13
R7305:Trpm6 UTSW 19 18876091 missense probably benign 0.30
R7498:Trpm6 UTSW 19 18876120 missense probably damaging 1.00
R7558:Trpm6 UTSW 19 18778665 missense probably damaging 0.96
R7590:Trpm6 UTSW 19 18832581 missense probably benign 0.31
R7646:Trpm6 UTSW 19 18867961 missense probably benign 0.10
R7650:Trpm6 UTSW 19 18876013 missense possibly damaging 0.70
R7727:Trpm6 UTSW 19 18854249 missense probably damaging 0.97
R7743:Trpm6 UTSW 19 18827408 missense probably benign 0.03
R7747:Trpm6 UTSW 19 18750045 splice site probably null
R7807:Trpm6 UTSW 19 18829856 missense probably benign 0.11
R7870:Trpm6 UTSW 19 18815241 missense probably benign 0.01
R7891:Trpm6 UTSW 19 18776710 missense probably benign 0.01
R7955:Trpm6 UTSW 19 18854290 missense probably benign 0.01
R7965:Trpm6 UTSW 19 18876110 missense probably damaging 1.00
R7967:Trpm6 UTSW 19 18778659 missense probably damaging 0.99
R7992:Trpm6 UTSW 19 18815350 missense probably damaging 1.00
R8035:Trpm6 UTSW 19 18792862 missense probably damaging 0.97
R8108:Trpm6 UTSW 19 18811790 missense probably damaging 1.00
R8268:Trpm6 UTSW 19 18873861 missense possibly damaging 0.85
R8411:Trpm6 UTSW 19 18853968 missense probably benign 0.39
R8413:Trpm6 UTSW 19 18832485 missense probably benign 0.00
R8534:Trpm6 UTSW 19 18892095 missense probably benign 0.00
R8932:Trpm6 UTSW 19 18838002 missense possibly damaging 0.87
R8990:Trpm6 UTSW 19 18815435 missense probably damaging 1.00
R9403:Trpm6 UTSW 19 18832652 missense possibly damaging 0.84
R9446:Trpm6 UTSW 19 18838098 missense possibly damaging 0.91
R9463:Trpm6 UTSW 19 18783900 critical splice donor site probably null
R9485:Trpm6 UTSW 19 18778614 missense probably benign 0.06
R9536:Trpm6 UTSW 19 18786759 missense probably damaging 1.00
R9549:Trpm6 UTSW 19 18876030 nonsense probably null
R9564:Trpm6 UTSW 19 18873876 missense possibly damaging 0.92
R9626:Trpm6 UTSW 19 18813482 missense probably damaging 1.00
R9655:Trpm6 UTSW 19 18892102 missense probably benign
R9721:Trpm6 UTSW 19 18829972 missense probably benign 0.12
R9742:Trpm6 UTSW 19 18823402 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TCACAGGTTTCTCGAGGTTTCC -3'
(R):5'- AAGCATGACTCTGTGCCTAC -3'

Sequencing Primer
(F):5'- GAGGTTTCCTTGGTCTACTGCC -3'
(R):5'- GTGCCTACATTTTCCCCTCAAAGAAG -3'
Posted On 2014-09-17