Mutagenetix > Incidental Mutations

Incidental Mutation 'R2075:Cnot1'

227530

Institutional Source

Beutler Lab

Gene Symbol

Cnot1

Ensembl Gene

ENSMUSG00000036550

Gene Name

CCR4-NOT transcription complex, subunit 1

Synonyms

6030411K04Rik

MMRRC Submission

040080-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2075 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

95719451-95807464 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 95739833 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Lysine at position 1592 (T1592K)

Ref Sequence

ENSEMBL: ENSMUSP00000148735 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000068452] [ENSMUST00000098473] [ENSMUST00000211887] [ENSMUST00000213006]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000068452
AA Change: T1587K

PolyPhen 2 Score 0.526 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000063565
Gene: ENSMUSG00000036550
AA Change: T1587K

Domain	Start	End	E-Value	Type
low complexity region	181	189	N/A	INTRINSIC
low complexity region	687	698	N/A	INTRINSIC
low complexity region	779	796	N/A	INTRINSIC
PDB:4J8S\|A	798	999	1e-137	PDB
low complexity region	1011	1028	N/A	INTRINSIC
low complexity region	1031	1055	N/A	INTRINSIC
PDB:4CT4\|C	1056	1295	1e-148	PDB
low complexity region	1296	1308	N/A	INTRINSIC
low complexity region	1328	1345	N/A	INTRINSIC
Pfam:DUF3819	1381	1530	2.5e-56	PFAM
low complexity region	1634	1648	N/A	INTRINSIC
Pfam:Not1	1991	2305	2.4e-125	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000098473
AA Change: T1592K

PolyPhen 2 Score 0.175 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000096073
Gene: ENSMUSG00000036550
AA Change: T1592K

Domain	Start	End	E-Value	Type
low complexity region	181	189	N/A	INTRINSIC
Pfam:CNOT1_HEAT	500	656	2.4e-57	PFAM
low complexity region	687	698	N/A	INTRINSIC
low complexity region	779	796	N/A	INTRINSIC
Pfam:CNOT1_TTP_bind	812	1004	1.4e-87	PFAM
low complexity region	1016	1033	N/A	INTRINSIC
low complexity region	1036	1060	N/A	INTRINSIC
Pfam:CNOT1_CAF1_bind	1087	1313	5.7e-99	PFAM
low complexity region	1333	1350	N/A	INTRINSIC
Pfam:DUF3819	1387	1534	2.3e-57	PFAM
low complexity region	1639	1653	N/A	INTRINSIC
Pfam:Not1	1998	2357	5.7e-157	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000211887
AA Change: T1585K

PolyPhen 2 Score 0.677 (Sensitivity: 0.86; Specificity: 0.92)

Predicted Effect

probably benign
Transcript: ENSMUST00000211973

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212195

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212340

Predicted Effect

probably benign
Transcript: ENSMUST00000212415

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212712

Predicted Effect

possibly damaging
Transcript: ENSMUST00000213006
AA Change: T1592K

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.0%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice hmozygous for a conditional allele activated in cardiomyocytes exhibit postnatal lethality, decreased cardiac muscle contractility, prolonged QT interval and cardiac muscle cell death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4922502D21Rik	C	T	6: 129,326,703	E100K	probably benign	Het
4930430A15Rik	T	C	2: 111,200,418	E382G	probably damaging	Het
Abca13	T	C	11: 9,522,382	F4263L	probably damaging	Het
Aebp2	G	A	6: 140,633,694	S219N	probably benign	Het
Anln	C	A	9: 22,333,168	W1083L	probably benign	Het
Atic	T	A	1: 71,576,127	D438E	probably benign	Het
Bahcc1	G	A	11: 120,271,689	C271Y	probably damaging	Het
Btbd17	A	T	11: 114,791,952		probably null	Het
Ccdc122	T	C	14: 77,068,951		probably null	Het
Ccdc149	A	G	5: 52,439,168	L34P	probably damaging	Het
Cd22	C	G	7: 30,869,698	C637S	probably damaging	Het
Ces1a	T	A	8: 93,048,075	N12Y	probably benign	Het
Chmp1a	A	T	8: 123,208,022	M65K	probably damaging	Het
Clec16a	G	A	16: 10,741,616	A918T	probably benign	Het
Ddx10	A	T	9: 53,240,505	D73E	probably benign	Het
Dhx32	T	C	7: 133,721,292	N731S	probably benign	Het
Dmd	G	C	X: 84,312,483	A2257P	probably benign	Het
Dna2	A	G	10: 62,969,822	Q946R	probably benign	Het
Duox2	T	A	2: 122,295,158	S323C	probably damaging	Het
Esr2	A	G	12: 76,165,447		probably null	Het
Fbxo9	G	T	9: 78,084,516	H397N	possibly damaging	Het
Fsip2	T	A	2: 82,988,579	N4885K	possibly damaging	Het
Gm12695	T	C	4: 96,723,945	Y527C	possibly damaging	Het
Hivep1	A	G	13: 42,156,318	D678G	probably damaging	Het
Hmcn1	T	A	1: 150,577,323	I5414F	possibly damaging	Het
Hspb2	T	C	9: 50,751,346	Y67C	probably benign	Het
Kbtbd8	T	A	6: 95,126,683	C438S	possibly damaging	Het
Kif5a	T	C	10: 127,245,369	D232G	probably damaging	Het
Ky	A	G	9: 102,542,746	S651G	probably damaging	Het
Lgals12	T	C	19: 7,598,845	D238G	possibly damaging	Het
Lpcat3	T	A	6: 124,703,103	Y380N	probably damaging	Het
Mdn1	A	G	4: 32,716,058	H2080R	probably benign	Het
Mex3c	C	T	18: 73,589,769	S311L	probably benign	Het
Mlh3	A	T	12: 85,269,141	Y90*	probably null	Het
Mpped2	T	A	2: 106,744,802	Y77*	probably null	Het
Myo5a	A	T	9: 75,189,918	T49S	probably benign	Het
Nsd1	T	C	13: 55,310,500	V2142A	possibly damaging	Het
Olfr1247	A	G	2: 89,609,478	V208A	probably benign	Het
Olfr201	T	C	16: 59,268,911	Y252C	possibly damaging	Het
Olfr64	T	A	7: 103,892,920	I272F	probably damaging	Het
Olfr641	T	A	7: 104,039,973	M59K	probably damaging	Het
Pdgfra	T	C	5: 75,187,948	I883T	probably damaging	Het
Pdzd2	A	G	15: 12,385,819	L955P	probably damaging	Het
Phf24	A	G	4: 42,939,507	Y333C	possibly damaging	Het
Phlpp2	T	C	8: 109,928,492	S605P	possibly damaging	Het
Piezo2	C	T	18: 63,081,734	E1263K	probably damaging	Het
Pitrm1	A	G	13: 6,555,383	T149A	probably damaging	Het
Pkhd1l1	G	T	15: 44,558,639	A3102S	probably damaging	Het
Plch2	A	T	4: 154,989,909	L754Q	probably damaging	Het
Polr2c	A	G	8: 94,863,567	I267V	probably benign	Het
Prss8	C	A	7: 127,927,094	R148L	possibly damaging	Het
Ptpn2	T	A	18: 67,681,475	T155S	probably damaging	Het
Ptprn2	G	A	12: 117,247,717	V839I	probably benign	Het
Sbp	A	G	17: 23,945,158		probably null	Het
Sec16a	A	G	2: 26,440,239	I588T	probably damaging	Het
Six2	A	G	17: 85,687,505	S150P	probably damaging	Het
Slc5a5	C	T	8: 70,892,439	G75R	possibly damaging	Het
Slc6a20b	T	A	9: 123,595,034	T623S	probably benign	Het
Sqle	T	A	15: 59,323,901	V342E	probably damaging	Het
Stk3	T	C	15: 34,959,049	M256V	possibly damaging	Het
Tek	A	G	4: 94,827,729	I463V	probably benign	Het
Tex10	C	T	4: 48,456,800	R637Q	probably benign	Het
Tnc	G	A	4: 63,995,666	T1303M	possibly damaging	Het
Traf6	A	C	2: 101,697,053	I383L	probably benign	Het
Tubb3	C	T	8: 123,421,270	A314V	probably damaging	Het
Vmn1r199	A	T	13: 22,383,265	Y243F	probably damaging	Het
Vmn2r111	A	C	17: 22,559,062	N545K	probably damaging	Het
Vmn2r27	T	A	6: 124,200,551	Q498L	possibly damaging	Het
Vstm4	A	T	14: 32,917,854	S229C	probably damaging	Het
Wdr12	C	T	1: 60,091,063	R63Q	possibly damaging	Het
Wdr78	G	A	4: 103,050,193	T632M	probably damaging	Het
Wrn	T	A	8: 33,322,329	I187L	probably benign	Het
Xirp2	A	T	2: 67,510,201	I929L	probably benign	Het
Ywhae	T	A	11: 75,764,660	D252E	probably benign	Het
Zfp944	A	T	17: 22,339,197	C356*	probably null	Het

Other mutations in Cnot1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00516:Cnot1	APN	8	95726079	missense	probably damaging	1.00
IGL01340:Cnot1	APN	8	95760537	missense	probably damaging	1.00
IGL01457:Cnot1	APN	8	95741009	missense	probably damaging	1.00
IGL01505:Cnot1	APN	8	95728718	missense	probably damaging	0.98
IGL02401:Cnot1	APN	8	95756133	missense	possibly damaging	0.95
IGL02693:Cnot1	APN	8	95773485	missense	probably damaging	1.00
IGL02696:Cnot1	APN	8	95745017	missense	probably benign	0.00
IGL02754:Cnot1	APN	8	95755078	missense	probably benign	0.03
IGL03092:Cnot1	APN	8	95769615	intron	probably benign
IGL03174:Cnot1	APN	8	95761355	missense	probably damaging	1.00
IGL03310:Cnot1	APN	8	95735680	splice site	probably benign
IGL03371:Cnot1	APN	8	95774716	missense	possibly damaging	0.85
barge	UTSW	8	95734129	missense	probably benign	0.13
kowloon	UTSW	8	95788658	missense	probably damaging	1.00
tugboat	UTSW	8	95773618	missense	probably damaging	0.99
Xiao	UTSW	8	95730420	missense	probably damaging	1.00
R0008:Cnot1	UTSW	8	95761341	missense	probably damaging	1.00
R0008:Cnot1	UTSW	8	95761341	missense	probably damaging	1.00
R0091:Cnot1	UTSW	8	95763144	missense	probably damaging	1.00
R0335:Cnot1	UTSW	8	95772000	missense	probably benign	0.02
R0409:Cnot1	UTSW	8	95748855	missense	probably damaging	0.96
R0445:Cnot1	UTSW	8	95760208	missense	probably damaging	1.00
R1505:Cnot1	UTSW	8	95728667	missense	probably damaging	1.00
R1517:Cnot1	UTSW	8	95743213	missense	probably benign	0.38
R1640:Cnot1	UTSW	8	95769832	missense	probably damaging	0.98
R1737:Cnot1	UTSW	8	95748276	missense	probably damaging	0.98
R1755:Cnot1	UTSW	8	95724577	missense	probably damaging	1.00
R1901:Cnot1	UTSW	8	95743121	missense	possibly damaging	0.50
R1902:Cnot1	UTSW	8	95743121	missense	possibly damaging	0.50
R1903:Cnot1	UTSW	8	95743121	missense	possibly damaging	0.50
R1988:Cnot1	UTSW	8	95741944	missense	possibly damaging	0.89
R2051:Cnot1	UTSW	8	95724593	missense	possibly damaging	0.47
R2054:Cnot1	UTSW	8	95739841	missense	possibly damaging	0.55
R2072:Cnot1	UTSW	8	95739833	missense	possibly damaging	0.89
R2074:Cnot1	UTSW	8	95739833	missense	possibly damaging	0.89
R2093:Cnot1	UTSW	8	95775358	missense	probably damaging	1.00
R2116:Cnot1	UTSW	8	95726153	missense	probably damaging	1.00
R2191:Cnot1	UTSW	8	95761426	missense	probably damaging	0.98
R2238:Cnot1	UTSW	8	95769521	missense	probably benign	0.04
R2239:Cnot1	UTSW	8	95769521	missense	probably benign	0.04
R2251:Cnot1	UTSW	8	95763186	missense	probably benign	0.00
R2252:Cnot1	UTSW	8	95763186	missense	probably benign	0.00
R2253:Cnot1	UTSW	8	95763186	missense	probably benign	0.00
R2315:Cnot1	UTSW	8	95749062	missense	probably damaging	1.00
R2431:Cnot1	UTSW	8	95774652	missense	probably damaging	1.00
R2988:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R2989:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3108:Cnot1	UTSW	8	95735749	missense	probably damaging	0.99
R3109:Cnot1	UTSW	8	95735749	missense	probably damaging	0.99
R3114:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3115:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3153:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3154:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R4112:Cnot1	UTSW	8	95773618	missense	probably damaging	0.99
R4359:Cnot1	UTSW	8	95739848	missense	probably damaging	1.00
R4382:Cnot1	UTSW	8	95769779	missense	probably damaging	0.97
R4747:Cnot1	UTSW	8	95774682	missense	probably benign	0.27
R4910:Cnot1	UTSW	8	95733231	missense	probably benign	0.43
R4913:Cnot1	UTSW	8	95763067	missense	possibly damaging	0.63
R4971:Cnot1	UTSW	8	95721626	missense	probably damaging	1.00
R5056:Cnot1	UTSW	8	95741008	missense	probably damaging	1.00
R5092:Cnot1	UTSW	8	95752768	missense	possibly damaging	0.91
R5101:Cnot1	UTSW	8	95760187	missense	possibly damaging	0.90
R5498:Cnot1	UTSW	8	95757355	missense	possibly damaging	0.92
R5719:Cnot1	UTSW	8	95744296	missense	possibly damaging	0.92
R5850:Cnot1	UTSW	8	95734147	nonsense	probably null
R5956:Cnot1	UTSW	8	95754978	critical splice donor site	probably null
R5981:Cnot1	UTSW	8	95788665	missense	probably damaging	1.00
R6093:Cnot1	UTSW	8	95748894	missense	probably benign	0.03
R6108:Cnot1	UTSW	8	95730420	missense	probably damaging	1.00
R6261:Cnot1	UTSW	8	95741921	missense	probably benign	0.00
R6632:Cnot1	UTSW	8	95773267	intron	probably benign
R6882:Cnot1	UTSW	8	95720426	missense	possibly damaging	0.85
R6966:Cnot1	UTSW	8	95724532	missense	probably damaging	1.00
R6985:Cnot1	UTSW	8	95734129	missense	probably benign	0.13
R7210:Cnot1	UTSW	8	95788658	missense	probably damaging	1.00
R7410:Cnot1	UTSW	8	95733159	missense	possibly damaging	0.77
R7623:Cnot1	UTSW	8	95727648	missense	probably damaging	1.00
R7624:Cnot1	UTSW	8	95751819	missense	probably damaging	1.00
R7695:Cnot1	UTSW	8	95770632	missense	probably benign	0.03
R7703:Cnot1	UTSW	8	95760098	critical splice donor site	probably null
R7771:Cnot1	UTSW	8	95765125	missense	probably damaging	0.99
R7800:Cnot1	UTSW	8	95765062	missense	probably benign	0.15
R7809:Cnot1	UTSW	8	95751778	missense	probably damaging	1.00
R7857:Cnot1	UTSW	8	95745647	frame shift	probably null
R7940:Cnot1	UTSW	8	95745647	frame shift	probably null
R8004:Cnot1	UTSW	8	95752752	missense	not run
R8061:Cnot1	UTSW	8	95765027	missense	not run
X0050:Cnot1	UTSW	8	95743098	splice site	probably null
Z1176:Cnot1	UTSW	8	95748277	missense	not run

Predicted Primers

PCR Primer
(F):5'- CACTGCTTGACATGCTGATCTAAC -3'
(R):5'- AGCTGGGCATTTTAGCAGGG -3'

Sequencing Primer
(F):5'- CAAAGATCAGTTGTAACCAATGGC -3'
(R):5'- AGTTTGAGACCAGCCTGATC -3'

Posted On

2014-09-17