Incidental Mutation 'R2075:Pdzd2'
ID 227566
Institutional Source Beutler Lab
Gene Symbol Pdzd2
Ensembl Gene ENSMUSG00000022197
Gene Name PDZ domain containing 2
Synonyms Pdzk3, A930022H17Rik, 4930537L06Rik, Gm21706, LOC223364
MMRRC Submission 040080-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.130) question?
Stock # R2075 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 12359711-12739924 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 12385819 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 955 (L955P)
Ref Sequence ENSEMBL: ENSMUSP00000074788 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075317]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000075317
AA Change: L955P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000074788
Gene: ENSMUSG00000022197
AA Change: L955P

DomainStartEndE-ValueType
PDZ 81 179 1.27e-2 SMART
PDZ 342 419 1.51e-18 SMART
PDZ 597 675 5.25e-18 SMART
low complexity region 690 718 N/A INTRINSIC
PDZ 738 817 1.64e-10 SMART
low complexity region 861 869 N/A INTRINSIC
low complexity region 969 984 N/A INTRINSIC
low complexity region 986 1000 N/A INTRINSIC
low complexity region 1436 1459 N/A INTRINSIC
low complexity region 1525 1537 N/A INTRINSIC
low complexity region 1538 1553 N/A INTRINSIC
low complexity region 1567 1586 N/A INTRINSIC
low complexity region 2111 2129 N/A INTRINSIC
low complexity region 2190 2198 N/A INTRINSIC
low complexity region 2335 2354 N/A INTRINSIC
low complexity region 2469 2479 N/A INTRINSIC
PDZ 2589 2666 1.3e-13 SMART
PDZ 2716 2794 9.42e-20 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains six PDZ domains and shares sequence similarity with pro-interleukin-16 (pro-IL-16). Like pro-IL-16, the encoded protein localizes to the endoplasmic reticulum and is thought to be cleaved by a caspase to produce a secreted peptide containing two PDZ domains. In addition, this gene is upregulated in primary prostate tumors and may be involved in the early stages of prostate tumorigenesis. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit normal response to acute and chronic pain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4922502D21Rik C T 6: 129,326,703 E100K probably benign Het
4930430A15Rik T C 2: 111,200,418 E382G probably damaging Het
Abca13 T C 11: 9,522,382 F4263L probably damaging Het
Aebp2 G A 6: 140,633,694 S219N probably benign Het
Anln C A 9: 22,333,168 W1083L probably benign Het
Atic T A 1: 71,576,127 D438E probably benign Het
Bahcc1 G A 11: 120,271,689 C271Y probably damaging Het
Btbd17 A T 11: 114,791,952 probably null Het
Ccdc122 T C 14: 77,068,951 probably null Het
Ccdc149 A G 5: 52,439,168 L34P probably damaging Het
Cd22 C G 7: 30,869,698 C637S probably damaging Het
Ces1a T A 8: 93,048,075 N12Y probably benign Het
Chmp1a A T 8: 123,208,022 M65K probably damaging Het
Clec16a G A 16: 10,741,616 A918T probably benign Het
Cnot1 G T 8: 95,739,833 T1592K possibly damaging Het
Ddx10 A T 9: 53,240,505 D73E probably benign Het
Dhx32 T C 7: 133,721,292 N731S probably benign Het
Dmd G C X: 84,312,483 A2257P probably benign Het
Dna2 A G 10: 62,969,822 Q946R probably benign Het
Duox2 T A 2: 122,295,158 S323C probably damaging Het
Esr2 A G 12: 76,165,447 probably null Het
Fbxo9 G T 9: 78,084,516 H397N possibly damaging Het
Fsip2 T A 2: 82,988,579 N4885K possibly damaging Het
Gm12695 T C 4: 96,723,945 Y527C possibly damaging Het
Hivep1 A G 13: 42,156,318 D678G probably damaging Het
Hmcn1 T A 1: 150,577,323 I5414F possibly damaging Het
Hspb2 T C 9: 50,751,346 Y67C probably benign Het
Kbtbd8 T A 6: 95,126,683 C438S possibly damaging Het
Kif5a T C 10: 127,245,369 D232G probably damaging Het
Ky A G 9: 102,542,746 S651G probably damaging Het
Lgals12 T C 19: 7,598,845 D238G possibly damaging Het
Lpcat3 T A 6: 124,703,103 Y380N probably damaging Het
Mdn1 A G 4: 32,716,058 H2080R probably benign Het
Mex3c C T 18: 73,589,769 S311L probably benign Het
Mlh3 A T 12: 85,269,141 Y90* probably null Het
Mpped2 T A 2: 106,744,802 Y77* probably null Het
Myo5a A T 9: 75,189,918 T49S probably benign Het
Nsd1 T C 13: 55,310,500 V2142A possibly damaging Het
Olfr1247 A G 2: 89,609,478 V208A probably benign Het
Olfr201 T C 16: 59,268,911 Y252C possibly damaging Het
Olfr64 T A 7: 103,892,920 I272F probably damaging Het
Olfr641 T A 7: 104,039,973 M59K probably damaging Het
Pdgfra T C 5: 75,187,948 I883T probably damaging Het
Phf24 A G 4: 42,939,507 Y333C possibly damaging Het
Phlpp2 T C 8: 109,928,492 S605P possibly damaging Het
Piezo2 C T 18: 63,081,734 E1263K probably damaging Het
Pitrm1 A G 13: 6,555,383 T149A probably damaging Het
Pkhd1l1 G T 15: 44,558,639 A3102S probably damaging Het
Plch2 A T 4: 154,989,909 L754Q probably damaging Het
Polr2c A G 8: 94,863,567 I267V probably benign Het
Prss8 C A 7: 127,927,094 R148L possibly damaging Het
Ptpn2 T A 18: 67,681,475 T155S probably damaging Het
Ptprn2 G A 12: 117,247,717 V839I probably benign Het
Sbp A G 17: 23,945,158 probably null Het
Sec16a A G 2: 26,440,239 I588T probably damaging Het
Six2 A G 17: 85,687,505 S150P probably damaging Het
Slc5a5 C T 8: 70,892,439 G75R possibly damaging Het
Slc6a20b T A 9: 123,595,034 T623S probably benign Het
Sqle T A 15: 59,323,901 V342E probably damaging Het
Stk3 T C 15: 34,959,049 M256V possibly damaging Het
Tek A G 4: 94,827,729 I463V probably benign Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tnc G A 4: 63,995,666 T1303M possibly damaging Het
Traf6 A C 2: 101,697,053 I383L probably benign Het
Tubb3 C T 8: 123,421,270 A314V probably damaging Het
Vmn1r199 A T 13: 22,383,265 Y243F probably damaging Het
Vmn2r111 A C 17: 22,559,062 N545K probably damaging Het
Vmn2r27 T A 6: 124,200,551 Q498L possibly damaging Het
Vstm4 A T 14: 32,917,854 S229C probably damaging Het
Wdr12 C T 1: 60,091,063 R63Q possibly damaging Het
Wdr78 G A 4: 103,050,193 T632M probably damaging Het
Wrn T A 8: 33,322,329 I187L probably benign Het
Xirp2 A T 2: 67,510,201 I929L probably benign Het
Ywhae T A 11: 75,764,660 D252E probably benign Het
Zfp944 A T 17: 22,339,197 C356* probably null Het
Other mutations in Pdzd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Pdzd2 APN 15 12457983 missense possibly damaging 0.93
IGL00586:Pdzd2 APN 15 12365767 splice site probably null
IGL00697:Pdzd2 APN 15 12373647 missense possibly damaging 0.81
IGL00721:Pdzd2 APN 15 12374412 missense probably benign 0.00
IGL00971:Pdzd2 APN 15 12374718 missense probably benign 0.00
IGL01066:Pdzd2 APN 15 12402632 unclassified probably benign
IGL01389:Pdzd2 APN 15 12374626 missense possibly damaging 0.56
IGL01505:Pdzd2 APN 15 12458207 missense probably damaging 1.00
IGL01527:Pdzd2 APN 15 12445664 missense probably damaging 1.00
IGL01584:Pdzd2 APN 15 12592483 missense probably damaging 1.00
IGL01763:Pdzd2 APN 15 12372546 missense probably benign
IGL01915:Pdzd2 APN 15 12371639 missense probably damaging 1.00
IGL01947:Pdzd2 APN 15 12592354 missense probably damaging 1.00
IGL02058:Pdzd2 APN 15 12376296 missense possibly damaging 0.87
IGL02274:Pdzd2 APN 15 12445649 missense probably damaging 1.00
IGL02408:Pdzd2 APN 15 12375765 missense probably benign 0.00
IGL02600:Pdzd2 APN 15 12411019 missense probably damaging 1.00
IGL02637:Pdzd2 APN 15 12385634 missense probably benign 0.13
IGL02639:Pdzd2 APN 15 12592243 missense probably damaging 1.00
IGL02712:Pdzd2 APN 15 12376027 missense probably benign 0.00
IGL02967:Pdzd2 APN 15 12374341 missense probably benign 0.04
IGL02992:Pdzd2 APN 15 12382622 missense possibly damaging 0.77
IGL03005:Pdzd2 APN 15 12385265 missense probably damaging 1.00
IGL03067:Pdzd2 APN 15 12388542 critical splice donor site probably null
IGL03335:Pdzd2 APN 15 12373764 missense probably benign 0.00
PIT4280001:Pdzd2 UTSW 15 12399288 missense probably damaging 1.00
R0022:Pdzd2 UTSW 15 12371605 missense possibly damaging 0.94
R0241:Pdzd2 UTSW 15 12367941 missense probably damaging 1.00
R0241:Pdzd2 UTSW 15 12367941 missense probably damaging 1.00
R0446:Pdzd2 UTSW 15 12375024 missense probably benign 0.43
R0462:Pdzd2 UTSW 15 12592160 missense probably damaging 1.00
R0562:Pdzd2 UTSW 15 12592278 missense probably damaging 1.00
R0589:Pdzd2 UTSW 15 12376299 missense probably benign 0.03
R0639:Pdzd2 UTSW 15 12458058 missense possibly damaging 0.77
R0925:Pdzd2 UTSW 15 12399270 missense probably damaging 1.00
R1015:Pdzd2 UTSW 15 12374508 missense probably damaging 1.00
R1054:Pdzd2 UTSW 15 12371639 missense probably damaging 1.00
R1070:Pdzd2 UTSW 15 12389966 critical splice donor site probably null
R1099:Pdzd2 UTSW 15 12373087 missense probably damaging 1.00
R1122:Pdzd2 UTSW 15 12457895 missense probably benign 0.25
R1126:Pdzd2 UTSW 15 12458220 missense possibly damaging 0.94
R1381:Pdzd2 UTSW 15 12385439 missense probably benign 0.02
R1385:Pdzd2 UTSW 15 12411022 missense probably benign 0.38
R1513:Pdzd2 UTSW 15 12373829 missense possibly damaging 0.88
R1538:Pdzd2 UTSW 15 12372961 missense probably damaging 1.00
R1750:Pdzd2 UTSW 15 12385864 missense probably damaging 1.00
R1775:Pdzd2 UTSW 15 12592460 missense probably damaging 1.00
R1801:Pdzd2 UTSW 15 12387654 missense possibly damaging 0.56
R1832:Pdzd2 UTSW 15 12390048 missense probably damaging 1.00
R1856:Pdzd2 UTSW 15 12373855 missense possibly damaging 0.87
R1870:Pdzd2 UTSW 15 12457886 missense probably damaging 1.00
R1879:Pdzd2 UTSW 15 12373900 missense possibly damaging 0.61
R2072:Pdzd2 UTSW 15 12385819 missense probably damaging 1.00
R2073:Pdzd2 UTSW 15 12385819 missense probably damaging 1.00
R2125:Pdzd2 UTSW 15 12373590 missense probably benign 0.37
R2142:Pdzd2 UTSW 15 12406559 missense probably damaging 1.00
R2155:Pdzd2 UTSW 15 12375793 missense probably benign 0.43
R2282:Pdzd2 UTSW 15 12373848 missense possibly damaging 0.95
R2407:Pdzd2 UTSW 15 12373161 missense probably damaging 1.00
R3545:Pdzd2 UTSW 15 12375471 missense probably benign 0.00
R3878:Pdzd2 UTSW 15 12376176 missense probably benign 0.00
R3879:Pdzd2 UTSW 15 12375508 missense probably damaging 1.00
R4396:Pdzd2 UTSW 15 12387646 missense probably benign 0.36
R4398:Pdzd2 UTSW 15 12375975 missense probably benign 0.30
R4491:Pdzd2 UTSW 15 12385637 missense possibly damaging 0.75
R4492:Pdzd2 UTSW 15 12385637 missense possibly damaging 0.75
R4492:Pdzd2 UTSW 15 12419481 missense possibly damaging 0.48
R4656:Pdzd2 UTSW 15 12385711 missense probably benign 0.00
R4715:Pdzd2 UTSW 15 12419516 missense possibly damaging 0.72
R4803:Pdzd2 UTSW 15 12374595 missense probably benign 0.04
R4893:Pdzd2 UTSW 15 12385343 missense probably benign 0.00
R4959:Pdzd2 UTSW 15 12375648 missense probably damaging 1.00
R4973:Pdzd2 UTSW 15 12375648 missense probably damaging 1.00
R5030:Pdzd2 UTSW 15 12592408 nonsense probably null
R5174:Pdzd2 UTSW 15 12372514 missense probably benign 0.01
R5230:Pdzd2 UTSW 15 12390033 missense probably damaging 1.00
R5256:Pdzd2 UTSW 15 12372942 missense possibly damaging 0.87
R5268:Pdzd2 UTSW 15 12592177 missense probably damaging 1.00
R5488:Pdzd2 UTSW 15 12382676 missense probably benign 0.00
R5489:Pdzd2 UTSW 15 12382676 missense probably benign 0.00
R5588:Pdzd2 UTSW 15 12374281 missense possibly damaging 0.48
R5605:Pdzd2 UTSW 15 12592350 nonsense probably null
R5704:Pdzd2 UTSW 15 12385675 missense probably benign 0.02
R5858:Pdzd2 UTSW 15 12442589 missense probably damaging 0.97
R6048:Pdzd2 UTSW 15 12592570 splice site probably null
R6222:Pdzd2 UTSW 15 12374566 missense probably damaging 1.00
R6311:Pdzd2 UTSW 15 12458188 missense probably damaging 1.00
R6734:Pdzd2 UTSW 15 12592465 missense probably damaging 1.00
R6897:Pdzd2 UTSW 15 12385865 missense probably damaging 1.00
R6900:Pdzd2 UTSW 15 12374037 missense probably benign
R6955:Pdzd2 UTSW 15 12401464 missense probably damaging 1.00
R6959:Pdzd2 UTSW 15 12375907 missense probably benign 0.17
R6992:Pdzd2 UTSW 15 12457859 missense probably damaging 1.00
R7014:Pdzd2 UTSW 15 12372561 missense probably benign 0.13
R7014:Pdzd2 UTSW 15 12372975 missense probably benign 0.14
R7110:Pdzd2 UTSW 15 12368013 missense probably damaging 1.00
R7180:Pdzd2 UTSW 15 12376123 missense probably damaging 0.99
R7228:Pdzd2 UTSW 15 12372973 missense probably benign 0.01
R7228:Pdzd2 UTSW 15 12458145 nonsense probably null
R7317:Pdzd2 UTSW 15 12592243 missense probably damaging 1.00
R7322:Pdzd2 UTSW 15 12437162 missense probably damaging 1.00
R7349:Pdzd2 UTSW 15 12399205 missense probably damaging 1.00
R7600:Pdzd2 UTSW 15 12372734 missense probably damaging 1.00
R7663:Pdzd2 UTSW 15 12373203 missense probably damaging 1.00
R7712:Pdzd2 UTSW 15 12407336 missense probably damaging 1.00
R7716:Pdzd2 UTSW 15 12373374 missense possibly damaging 0.63
R7740:Pdzd2 UTSW 15 12374016 missense probably benign 0.00
R7748:Pdzd2 UTSW 15 12385786 missense possibly damaging 0.60
R8017:Pdzd2 UTSW 15 12373036 missense probably damaging 1.00
R8019:Pdzd2 UTSW 15 12373036 missense probably damaging 1.00
R8108:Pdzd2 UTSW 15 12373506 missense probably benign 0.01
R8109:Pdzd2 UTSW 15 12373506 missense probably benign 0.01
R8110:Pdzd2 UTSW 15 12373506 missense probably benign 0.01
R8111:Pdzd2 UTSW 15 12373506 missense probably benign 0.01
R8145:Pdzd2 UTSW 15 12407372 missense probably benign 0.37
R8220:Pdzd2 UTSW 15 12592163 missense probably damaging 0.99
R8278:Pdzd2 UTSW 15 12375909 missense probably benign
R8768:Pdzd2 UTSW 15 12437166 missense probably damaging 1.00
R8879:Pdzd2 UTSW 15 12402319 missense probably damaging 1.00
R9019:Pdzd2 UTSW 15 12375526 missense probably damaging 1.00
R9030:Pdzd2 UTSW 15 12374299 missense probably benign 0.02
R9061:Pdzd2 UTSW 15 12374667 missense possibly damaging 0.94
R9302:Pdzd2 UTSW 15 12374256 missense possibly damaging 0.61
R9321:Pdzd2 UTSW 15 12385937 missense probably benign 0.00
R9421:Pdzd2 UTSW 15 12375028 missense not run
X0057:Pdzd2 UTSW 15 12411027 missense probably damaging 1.00
X0063:Pdzd2 UTSW 15 12368719 missense possibly damaging 0.77
X0066:Pdzd2 UTSW 15 12372856 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTGGAGTCGTTCATCCTGCTTG -3'
(R):5'- AGCCAGGCCAGATTGGAAAC -3'

Sequencing Primer
(F):5'- CAATACTTTTGGAAGAGGTTGCC -3'
(R):5'- CAGGCCAGATTGGAAACTTGTGTTC -3'
Posted On 2014-09-17