Mutagenetix > Incidental Mutations

Incidental Mutation 'R2075:Clec16a'

227570

Institutional Source

Beutler Lab

Gene Symbol

Clec16a

Ensembl Gene

ENSMUSG00000068663

Gene Name

C-type lectin domain family 16, member A

Synonyms

4932416N17Rik, curt

MMRRC Submission

040080-MU

Accession Numbers

NCBI RefSeq: NM_177562.5, NM_001204229.1; MGI: 1921624

Is this an essential gene?

Probably non essential (E-score: 0.181) question?

Stock #

R2075 (G1)

Quality Score

179

Status

Not validated

Chromosome

Chromosomal Location

10545339-10744878 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 10741616 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 918 (A918T)

Ref Sequence

ENSEMBL: ENSMUSP00000123189 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000066345] [ENSMUST00000115823] [ENSMUST00000115824] [ENSMUST00000115828] [ENSMUST00000155633]

Predicted Effect

probably benign
Transcript: ENSMUST00000066345
AA Change: A920T

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000065423
Gene: ENSMUSG00000068663
AA Change: A920T

Domain	Start	End	E-Value	Type
Pfam:FPL	51	199	1.1e-60	PFAM
coiled coil region	398	419	N/A	INTRINSIC
low complexity region	877	924	N/A	INTRINSIC
low complexity region	943	955	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000115823

SMART Domains

Protein: ENSMUSP00000111489
Gene: ENSMUSG00000068663

Domain	Start	End	E-Value	Type
low complexity region	456	491	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000115824
AA Change: A920T

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000111490
Gene: ENSMUSG00000068663
AA Change: A920T

Domain	Start	End	E-Value	Type
Pfam:FPL	51	198	5.9e-66	PFAM
coiled coil region	398	419	N/A	INTRINSIC
low complexity region	877	924	N/A	INTRINSIC
low complexity region	943	955	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000115828

SMART Domains

Protein: ENSMUSP00000111494
Gene: ENSMUSG00000068663

Domain	Start	End	E-Value	Type
Pfam:FPL	51	199	2.1e-61	PFAM
low complexity region	395	408	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000155633
AA Change: A918T

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000123189
Gene: ENSMUSG00000068663
AA Change: A918T

Domain	Start	End	E-Value	Type
Pfam:FPL	51	199	1.1e-60	PFAM
coiled coil region	396	417	N/A	INTRINSIC
low complexity region	875	922	N/A	INTRINSIC
low complexity region	941	953	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the C-type lectin domain containing family. Single nucleotide polymorphisms in introns of this gene have been associated with diabetes mellitus, multiple sclerosis and rheumatoid arthritis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygotes for a spontaneous mutation have a curved tail, small body size, squinting eyes, crooked digits that curve outward, and premature death. [provided by MGI curators]

Allele List at MGI

All alleles(13) : Gene trapped(13)

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4922502D21Rik	C	T	6: 129,326,703	E100K	probably benign	Het
4930430A15Rik	T	C	2: 111,200,418	E382G	probably damaging	Het
Abca13	T	C	11: 9,522,382	F4263L	probably damaging	Het
Aebp2	G	A	6: 140,633,694	S219N	probably benign	Het
Anln	C	A	9: 22,333,168	W1083L	probably benign	Het
Atic	T	A	1: 71,576,127	D438E	probably benign	Het
Bahcc1	G	A	11: 120,271,689	C271Y	probably damaging	Het
Btbd17	A	T	11: 114,791,952		probably null	Het
Ccdc122	T	C	14: 77,068,951		probably null	Het
Ccdc149	A	G	5: 52,439,168	L34P	probably damaging	Het
Cd22	C	G	7: 30,869,698	C637S	probably damaging	Het
Ces1a	T	A	8: 93,048,075	N12Y	probably benign	Het
Chmp1a	A	T	8: 123,208,022	M65K	probably damaging	Het
Cnot1	G	T	8: 95,739,833	T1592K	possibly damaging	Het
Ddx10	A	T	9: 53,240,505	D73E	probably benign	Het
Dhx32	T	C	7: 133,721,292	N731S	probably benign	Het
Dmd	G	C	X: 84,312,483	A2257P	probably benign	Het
Dna2	A	G	10: 62,969,822	Q946R	probably benign	Het
Duox2	T	A	2: 122,295,158	S323C	probably damaging	Het
Esr2	A	G	12: 76,165,447		probably null	Het
Fbxo9	G	T	9: 78,084,516	H397N	possibly damaging	Het
Fsip2	T	A	2: 82,988,579	N4885K	possibly damaging	Het
Gm12695	T	C	4: 96,723,945	Y527C	possibly damaging	Het
Hivep1	A	G	13: 42,156,318	D678G	probably damaging	Het
Hmcn1	T	A	1: 150,577,323	I5414F	possibly damaging	Het
Hspb2	T	C	9: 50,751,346	Y67C	probably benign	Het
Kbtbd8	T	A	6: 95,126,683	C438S	possibly damaging	Het
Kif5a	T	C	10: 127,245,369	D232G	probably damaging	Het
Ky	A	G	9: 102,542,746	S651G	probably damaging	Het
Lgals12	T	C	19: 7,598,845	D238G	possibly damaging	Het
Lpcat3	T	A	6: 124,703,103	Y380N	probably damaging	Het
Mdn1	A	G	4: 32,716,058	H2080R	probably benign	Het
Mex3c	C	T	18: 73,589,769	S311L	probably benign	Het
Mlh3	A	T	12: 85,269,141	Y90*	probably null	Het
Mpped2	T	A	2: 106,744,802	Y77*	probably null	Het
Myo5a	A	T	9: 75,189,918	T49S	probably benign	Het
Nsd1	T	C	13: 55,310,500	V2142A	possibly damaging	Het
Olfr1247	A	G	2: 89,609,478	V208A	probably benign	Het
Olfr201	T	C	16: 59,268,911	Y252C	possibly damaging	Het
Olfr64	T	A	7: 103,892,920	I272F	probably damaging	Het
Olfr641	T	A	7: 104,039,973	M59K	probably damaging	Het
Pdgfra	T	C	5: 75,187,948	I883T	probably damaging	Het
Pdzd2	A	G	15: 12,385,819	L955P	probably damaging	Het
Phf24	A	G	4: 42,939,507	Y333C	possibly damaging	Het
Phlpp2	T	C	8: 109,928,492	S605P	possibly damaging	Het
Piezo2	C	T	18: 63,081,734	E1263K	probably damaging	Het
Pitrm1	A	G	13: 6,555,383	T149A	probably damaging	Het
Pkhd1l1	G	T	15: 44,558,639	A3102S	probably damaging	Het
Plch2	A	T	4: 154,989,909	L754Q	probably damaging	Het
Polr2c	A	G	8: 94,863,567	I267V	probably benign	Het
Prss8	C	A	7: 127,927,094	R148L	possibly damaging	Het
Ptpn2	T	A	18: 67,681,475	T155S	probably damaging	Het
Ptprn2	G	A	12: 117,247,717	V839I	probably benign	Het
Sbp	A	G	17: 23,945,158		probably null	Het
Sec16a	A	G	2: 26,440,239	I588T	probably damaging	Het
Six2	A	G	17: 85,687,505	S150P	probably damaging	Het
Slc5a5	C	T	8: 70,892,439	G75R	possibly damaging	Het
Slc6a20b	T	A	9: 123,595,034	T623S	probably benign	Het
Sqle	T	A	15: 59,323,901	V342E	probably damaging	Het
Stk3	T	C	15: 34,959,049	M256V	possibly damaging	Het
Tek	A	G	4: 94,827,729	I463V	probably benign	Het
Tex10	C	T	4: 48,456,800	R637Q	probably benign	Het
Tnc	G	A	4: 63,995,666	T1303M	possibly damaging	Het
Traf6	A	C	2: 101,697,053	I383L	probably benign	Het
Tubb3	C	T	8: 123,421,270	A314V	probably damaging	Het
Vmn1r199	A	T	13: 22,383,265	Y243F	probably damaging	Het
Vmn2r111	A	C	17: 22,559,062	N545K	probably damaging	Het
Vmn2r27	T	A	6: 124,200,551	Q498L	possibly damaging	Het
Vstm4	A	T	14: 32,917,854	S229C	probably damaging	Het
Wdr12	C	T	1: 60,091,063	R63Q	possibly damaging	Het
Wdr78	G	A	4: 103,050,193	T632M	probably damaging	Het
Wrn	T	A	8: 33,322,329	I187L	probably benign	Het
Xirp2	A	T	2: 67,510,201	I929L	probably benign	Het
Ywhae	T	A	11: 75,764,660	D252E	probably benign	Het
Zfp944	A	T	17: 22,339,197	C356*	probably null	Het

Other mutations in Clec16a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00494:Clec16a	APN	16	10595896	missense	probably damaging	1.00
IGL00503:Clec16a	APN	16	10694649	missense	possibly damaging	0.53
IGL01622:Clec16a	APN	16	10577910	missense	possibly damaging	0.47
IGL01623:Clec16a	APN	16	10577910	missense	possibly damaging	0.47
IGL02008:Clec16a	APN	16	10580960	missense	probably damaging	1.00
IGL02082:Clec16a	APN	16	10614568	missense	probably damaging	1.00
IGL02468:Clec16a	APN	16	10741878	missense	probably benign	0.13
IGL02499:Clec16a	APN	16	10694676	missense	probably benign	0.25
IGL02671:Clec16a	APN	16	10627381	missense	probably benign	0.19
G5030:Clec16a	UTSW	16	10571561	missense	probably damaging	1.00
IGL03055:Clec16a	UTSW	16	10741781	missense	probably damaging	0.99
P0014:Clec16a	UTSW	16	10560156	splice site	probably benign
R0183:Clec16a	UTSW	16	10560022	missense	probably damaging	1.00
R0268:Clec16a	UTSW	16	10644828	nonsense	probably null
R0512:Clec16a	UTSW	16	10614580	missense	probably damaging	1.00
R0556:Clec16a	UTSW	16	10638785	critical splice acceptor site	probably null
R0944:Clec16a	UTSW	16	10688646	splice site	probably benign
R1456:Clec16a	UTSW	16	10691555	missense	probably damaging	1.00
R1497:Clec16a	UTSW	16	10635259	missense	probably damaging	1.00
R1580:Clec16a	UTSW	16	10595898	missense	probably damaging	1.00
R1933:Clec16a	UTSW	16	10688539	missense	probably damaging	0.99
R2269:Clec16a	UTSW	16	10644786	missense	probably damaging	1.00
R2504:Clec16a	UTSW	16	10559687	intron	probably benign
R3011:Clec16a	UTSW	16	10611111	missense	probably benign	0.01
R4331:Clec16a	UTSW	16	10571669	missense	probably benign
R4616:Clec16a	UTSW	16	10644883	critical splice donor site	probably null
R4775:Clec16a	UTSW	16	10638914	missense	probably damaging	1.00
R4969:Clec16a	UTSW	16	10568511	missense	probably damaging	1.00
R5053:Clec16a	UTSW	16	10576597	missense	probably damaging	1.00
R5170:Clec16a	UTSW	16	10741791	missense	probably benign
R5329:Clec16a	UTSW	16	10731679	missense	probably damaging	0.99
R5331:Clec16a	UTSW	16	10731679	missense	probably damaging	0.99
R5332:Clec16a	UTSW	16	10731679	missense	probably damaging	0.99
R5417:Clec16a	UTSW	16	10731679	missense	probably damaging	0.99
R5419:Clec16a	UTSW	16	10731679	missense	probably damaging	0.99
R5420:Clec16a	UTSW	16	10731679	missense	probably damaging	0.99
R5457:Clec16a	UTSW	16	10545532	unclassified	probably null
R5623:Clec16a	UTSW	16	10611121	missense	probably benign	0.07
R6057:Clec16a	UTSW	16	10630087	missense	probably damaging	1.00
R6184:Clec16a	UTSW	16	10572928	splice site	probably null
R6235:Clec16a	UTSW	16	10694635	missense	probably damaging	1.00
R6260:Clec16a	UTSW	16	10694848	intron	probably benign
R6292:Clec16a	UTSW	16	10560151	critical splice donor site	probably null
R6318:Clec16a	UTSW	16	10630788	missense	probably damaging	1.00
R6894:Clec16a	UTSW	16	10644854	missense	probably damaging	1.00
R7340:Clec16a	UTSW	16	10580963	missense	probably null	0.21
R7432:Clec16a	UTSW	16	10688555	missense	possibly damaging	0.62
R7453:Clec16a	UTSW	16	10644822	missense	probably damaging	1.00
R7536:Clec16a	UTSW	16	10638844	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- CCCTAGGCCTAAGTTAGATGAAGC -3'
(R):5'- CAATGGTCAGTGACTCGACAC -3'

Sequencing Primer
(F):5'- CCTAAGTTAGATGAAGCTAGGAGC -3'
(R):5'- CACTCAGTGTGTCAGCAGTGTC -3'

Posted On

2014-09-17