Mutagenetix > Incidental Mutation

Incidental Mutation 'R2075:Vmn2r111'

227573

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r111

Ensembl Gene

ENSMUSG00000095093

Gene Name

vomeronasal 2, receptor 111

Synonyms

EG210876

MMRRC Submission

040080-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.088) question?

Stock #

R2075 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

22547941-22573273 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 22559062 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 545 (N545K)

Ref Sequence

ENSEMBL: ENSMUSP00000090148 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092491]

AlphaFold

K7N674

Predicted Effect

probably damaging
Transcript: ENSMUST00000092491
AA Change: N545K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000090148
Gene: ENSMUSG00000095093
AA Change: N545K

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	73	469	2.5e-29	PFAM
Pfam:NCD3G	512	565	1.1e-20	PFAM
Pfam:7tm_3	595	833	5.6e-54	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.0%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4922502D21Rik	C	T	6: 129,326,703	E100K	probably benign	Het
4930430A15Rik	T	C	2: 111,200,418	E382G	probably damaging	Het
Abca13	T	C	11: 9,522,382	F4263L	probably damaging	Het
Aebp2	G	A	6: 140,633,694	S219N	probably benign	Het
Anln	C	A	9: 22,333,168	W1083L	probably benign	Het
Atic	T	A	1: 71,576,127	D438E	probably benign	Het
Bahcc1	G	A	11: 120,271,689	C271Y	probably damaging	Het
Btbd17	A	T	11: 114,791,952		probably null	Het
Ccdc122	T	C	14: 77,068,951		probably null	Het
Ccdc149	A	G	5: 52,439,168	L34P	probably damaging	Het
Cd22	C	G	7: 30,869,698	C637S	probably damaging	Het
Ces1a	T	A	8: 93,048,075	N12Y	probably benign	Het
Chmp1a	A	T	8: 123,208,022	M65K	probably damaging	Het
Clec16a	G	A	16: 10,741,616	A918T	probably benign	Het
Cnot1	G	T	8: 95,739,833	T1592K	possibly damaging	Het
Ddx10	A	T	9: 53,240,505	D73E	probably benign	Het
Dhx32	T	C	7: 133,721,292	N731S	probably benign	Het
Dmd	G	C	X: 84,312,483	A2257P	probably benign	Het
Dna2	A	G	10: 62,969,822	Q946R	probably benign	Het
Duox2	T	A	2: 122,295,158	S323C	probably damaging	Het
Esr2	A	G	12: 76,165,447		probably null	Het
Fbxo9	G	T	9: 78,084,516	H397N	possibly damaging	Het
Fsip2	T	A	2: 82,988,579	N4885K	possibly damaging	Het
Gm12695	T	C	4: 96,723,945	Y527C	possibly damaging	Het
Hivep1	A	G	13: 42,156,318	D678G	probably damaging	Het
Hmcn1	T	A	1: 150,577,323	I5414F	possibly damaging	Het
Hspb2	T	C	9: 50,751,346	Y67C	probably benign	Het
Kbtbd8	T	A	6: 95,126,683	C438S	possibly damaging	Het
Kif5a	T	C	10: 127,245,369	D232G	probably damaging	Het
Ky	A	G	9: 102,542,746	S651G	probably damaging	Het
Lgals12	T	C	19: 7,598,845	D238G	possibly damaging	Het
Lpcat3	T	A	6: 124,703,103	Y380N	probably damaging	Het
Mdn1	A	G	4: 32,716,058	H2080R	probably benign	Het
Mex3c	C	T	18: 73,589,769	S311L	probably benign	Het
Mlh3	A	T	12: 85,269,141	Y90*	probably null	Het
Mpped2	T	A	2: 106,744,802	Y77*	probably null	Het
Myo5a	A	T	9: 75,189,918	T49S	probably benign	Het
Nsd1	T	C	13: 55,310,500	V2142A	possibly damaging	Het
Olfr1247	A	G	2: 89,609,478	V208A	probably benign	Het
Olfr201	T	C	16: 59,268,911	Y252C	possibly damaging	Het
Olfr64	T	A	7: 103,892,920	I272F	probably damaging	Het
Olfr641	T	A	7: 104,039,973	M59K	probably damaging	Het
Pdgfra	T	C	5: 75,187,948	I883T	probably damaging	Het
Pdzd2	A	G	15: 12,385,819	L955P	probably damaging	Het
Phf24	A	G	4: 42,939,507	Y333C	possibly damaging	Het
Phlpp2	T	C	8: 109,928,492	S605P	possibly damaging	Het
Piezo2	C	T	18: 63,081,734	E1263K	probably damaging	Het
Pitrm1	A	G	13: 6,555,383	T149A	probably damaging	Het
Pkhd1l1	G	T	15: 44,558,639	A3102S	probably damaging	Het
Plch2	A	T	4: 154,989,909	L754Q	probably damaging	Het
Polr2c	A	G	8: 94,863,567	I267V	probably benign	Het
Prss8	C	A	7: 127,927,094	R148L	possibly damaging	Het
Ptpn2	T	A	18: 67,681,475	T155S	probably damaging	Het
Ptprn2	G	A	12: 117,247,717	V839I	probably benign	Het
Sbp	A	G	17: 23,945,158		probably null	Het
Sec16a	A	G	2: 26,440,239	I588T	probably damaging	Het
Six2	A	G	17: 85,687,505	S150P	probably damaging	Het
Slc5a5	C	T	8: 70,892,439	G75R	possibly damaging	Het
Slc6a20b	T	A	9: 123,595,034	T623S	probably benign	Het
Sqle	T	A	15: 59,323,901	V342E	probably damaging	Het
Stk3	T	C	15: 34,959,049	M256V	possibly damaging	Het
Tek	A	G	4: 94,827,729	I463V	probably benign	Het
Tex10	C	T	4: 48,456,800	R637Q	probably benign	Het
Tnc	G	A	4: 63,995,666	T1303M	possibly damaging	Het
Traf6	A	C	2: 101,697,053	I383L	probably benign	Het
Tubb3	C	T	8: 123,421,270	A314V	probably damaging	Het
Vmn1r199	A	T	13: 22,383,265	Y243F	probably damaging	Het
Vmn2r27	T	A	6: 124,200,551	Q498L	possibly damaging	Het
Vstm4	A	T	14: 32,917,854	S229C	probably damaging	Het
Wdr12	C	T	1: 60,091,063	R63Q	possibly damaging	Het
Wdr78	G	A	4: 103,050,193	T632M	probably damaging	Het
Wrn	T	A	8: 33,322,329	I187L	probably benign	Het
Xirp2	A	T	2: 67,510,201	I929L	probably benign	Het
Ywhae	T	A	11: 75,764,660	D252E	probably benign	Het
Zfp944	A	T	17: 22,339,197	C356*	probably null	Het

Other mutations in Vmn2r111

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00932:Vmn2r111	APN	17	22548753	missense	probably benign	0.00
IGL01306:Vmn2r111	APN	17	22568984	missense	probably damaging	0.99
IGL01309:Vmn2r111	APN	17	22569016	missense	possibly damaging	0.51
IGL01457:Vmn2r111	APN	17	22571985	nonsense	probably null
IGL01465:Vmn2r111	APN	17	22548737	missense	probably benign	0.00
IGL01505:Vmn2r111	APN	17	22548572	missense	probably benign	0.00
IGL01571:Vmn2r111	APN	17	22571392	missense	probably damaging	0.99
IGL01715:Vmn2r111	APN	17	22569073	splice site	probably benign
IGL01962:Vmn2r111	APN	17	22548284	missense	possibly damaging	0.90
IGL02190:Vmn2r111	APN	17	22570773	missense	probably benign	0.00
IGL02496:Vmn2r111	APN	17	22568856	missense	probably benign
IGL02519:Vmn2r111	APN	17	22548339	missense	possibly damaging	0.80
IGL02616:Vmn2r111	APN	17	22571050	missense	possibly damaging	0.67
IGL02641:Vmn2r111	APN	17	22573224	missense	possibly damaging	0.82
IGL02690:Vmn2r111	APN	17	22559042	critical splice donor site	probably null
IGL02698:Vmn2r111	APN	17	22571245	missense	probably damaging	1.00
IGL03017:Vmn2r111	APN	17	22570858	missense	probably damaging	1.00
R0046:Vmn2r111	UTSW	17	22548009	missense	probably benign
R0064:Vmn2r111	UTSW	17	22572072	missense	probably benign	0.00
R0519:Vmn2r111	UTSW	17	22573121	missense	probably benign	0.02
R1439:Vmn2r111	UTSW	17	22571116	missense	probably benign	0.00
R1467:Vmn2r111	UTSW	17	22571047	missense	probably damaging	0.99
R1467:Vmn2r111	UTSW	17	22571047	missense	probably damaging	0.99
R1636:Vmn2r111	UTSW	17	22571399	missense	probably damaging	1.00
R1647:Vmn2r111	UTSW	17	22569061	missense	probably benign	0.03
R1648:Vmn2r111	UTSW	17	22569061	missense	probably benign	0.03
R1697:Vmn2r111	UTSW	17	22548060	missense	probably benign	0.26
R1996:Vmn2r111	UTSW	17	22548081	missense	probably benign	0.21
R2040:Vmn2r111	UTSW	17	22548414	missense	probably damaging	1.00
R2134:Vmn2r111	UTSW	17	22573104	missense	possibly damaging	0.68
R2357:Vmn2r111	UTSW	17	22559170	splice site	probably benign
R3700:Vmn2r111	UTSW	17	22571161	nonsense	probably null
R3782:Vmn2r111	UTSW	17	22571320	missense	possibly damaging	0.89
R4085:Vmn2r111	UTSW	17	22559115	missense	probably benign	0.00
R4323:Vmn2r111	UTSW	17	22573178	missense	probably benign	0.02
R4900:Vmn2r111	UTSW	17	22548656	missense	possibly damaging	0.94
R5072:Vmn2r111	UTSW	17	22548041	missense	probably damaging	0.99
R5123:Vmn2r111	UTSW	17	22571143	missense	possibly damaging	0.82
R5181:Vmn2r111	UTSW	17	22571020	missense	possibly damaging	0.56
R5357:Vmn2r111	UTSW	17	22548102	nonsense	probably null
R5398:Vmn2r111	UTSW	17	22573271	start codon destroyed	probably null	0.88
R5434:Vmn2r111	UTSW	17	22548489	missense	probably damaging	0.99
R5462:Vmn2r111	UTSW	17	22548257	missense	probably damaging	1.00
R6149:Vmn2r111	UTSW	17	22548815	missense	probably benign	0.00
R6149:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6207:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6281:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6282:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6283:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6307:Vmn2r111	UTSW	17	22573089	missense	probably benign	0.00
R6323:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6325:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6367:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6368:Vmn2r111	UTSW	17	22571908	missense	probably benign	0.38
R6369:Vmn2r111	UTSW	17	22548602	missense	probably damaging	1.00
R6489:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6490:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6546:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6547:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6557:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6654:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6655:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6657:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6659:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6660:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6664:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6798:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6799:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6801:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6893:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6895:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6897:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6922:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6923:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6944:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6945:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7017:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7018:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7024:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7031:Vmn2r111	UTSW	17	22571245	missense	probably damaging	1.00
R7039:Vmn2r111	UTSW	17	22548184	missense	probably damaging	1.00
R7053:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7054:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7055:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7056:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7145:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7146:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7246:Vmn2r111	UTSW	17	22548714	missense	probably damaging	1.00
R7259:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7260:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7327:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7401:Vmn2r111	UTSW	17	22571086	missense	possibly damaging	0.93
R7514:Vmn2r111	UTSW	17	22548399	missense	probably benign	0.05
R7651:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7781:Vmn2r111	UTSW	17	22570733	missense	probably benign	0.17
R7816:Vmn2r111	UTSW	17	22573102	missense	probably damaging	0.97
R7821:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7838:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8078:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8080:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8117:Vmn2r111	UTSW	17	22571488	missense	probably benign	0.12
R8171:Vmn2r111	UTSW	17	22573092	missense	probably benign	0.10
R8195:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8197:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8411:Vmn2r111	UTSW	17	22548581	missense	probably benign	0.03
R8539:Vmn2r111	UTSW	17	22571293	missense	probably benign	0.23
R8540:Vmn2r111	UTSW	17	22559042	critical splice donor site	probably null
R8540:Vmn2r111	UTSW	17	22559043	missense	probably damaging	1.00
R8557:Vmn2r111	UTSW	17	22571929	nonsense	probably null
R8720:Vmn2r111	UTSW	17	22573213	missense	possibly damaging	0.88
R8729:Vmn2r111	UTSW	17	22548258	missense	probably damaging	1.00
R8843:Vmn2r111	UTSW	17	22548030	missense	probably benign	0.00
R9184:Vmn2r111	UTSW	17	22571841	missense	probably benign
R9374:Vmn2r111	UTSW	17	22568878	missense	probably benign	0.17
R9452:Vmn2r111	UTSW	17	22559151	missense	probably damaging	1.00
X0026:Vmn2r111	UTSW	17	22548695	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- AAAGATGCAGCCCAATTTCTAC -3'
(R):5'- TCAAGGAGTTGGGAAACAATTCAAC -3'

Sequencing Primer
(F):5'- TGAGTAACTTAGGACAGAGAT -3'
(R):5'- ACAATGCACTAAATAAGGTCTGC -3'

Posted On

2014-09-17