Incidental Mutation 'R2127:Zfp408'
ID227588
Institutional Source Beutler Lab
Gene Symbol Zfp408
Ensembl Gene ENSMUSG00000075040
Gene Namezinc finger protein 408
SynonymsLOC381410
MMRRC Submission 040130-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2127 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location91643669-91649791 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 91645174 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 545 (E545G)
Ref Sequence ENSEMBL: ENSMUSP00000106965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099714] [ENSMUST00000111329] [ENSMUST00000111331] [ENSMUST00000111333] [ENSMUST00000145582]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099714
AA Change: E645G

PolyPhen 2 Score 0.608 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000097301
Gene: ENSMUSG00000075040
AA Change: E645G

DomainStartEndE-ValueType
ZnF_C2H2 344 366 7.05e-1 SMART
ZnF_C2H2 372 394 1.67e-2 SMART
ZnF_C2H2 400 422 2.24e-3 SMART
ZnF_C2H2 428 450 8.6e-5 SMART
ZnF_C2H2 459 481 5.9e-3 SMART
ZnF_C2H2 487 509 4.87e-4 SMART
ZnF_C2H2 515 537 2.95e-3 SMART
ZnF_C2H2 542 564 2.2e-2 SMART
ZnF_C2H2 570 592 1.69e-3 SMART
ZnF_C2H2 598 620 3.89e-3 SMART
low complexity region 625 638 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111329
SMART Domains Protein: ENSMUSP00000106961
Gene: ENSMUSG00000027247

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
low complexity region 42 52 N/A INTRINSIC
SEC14 64 215 5.08e-25 SMART
low complexity region 224 238 N/A INTRINSIC
RhoGAP 257 428 1.06e-61 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111331
SMART Domains Protein: ENSMUSP00000106963
Gene: ENSMUSG00000027247

DomainStartEndE-ValueType
low complexity region 44 58 N/A INTRINSIC
low complexity region 82 92 N/A INTRINSIC
SEC14 104 255 5.08e-25 SMART
low complexity region 264 278 N/A INTRINSIC
RhoGAP 297 468 1.06e-61 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111333
AA Change: E545G

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106965
Gene: ENSMUSG00000075040
AA Change: E545G

DomainStartEndE-ValueType
ZnF_C2H2 244 266 7.05e-1 SMART
ZnF_C2H2 272 294 1.67e-2 SMART
ZnF_C2H2 300 322 2.24e-3 SMART
ZnF_C2H2 328 350 8.6e-5 SMART
ZnF_C2H2 359 381 5.9e-3 SMART
ZnF_C2H2 387 409 4.87e-4 SMART
ZnF_C2H2 415 437 2.95e-3 SMART
ZnF_C2H2 442 464 2.2e-2 SMART
ZnF_C2H2 470 492 1.69e-3 SMART
ZnF_C2H2 498 520 3.89e-3 SMART
low complexity region 525 538 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117988
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127702
Predicted Effect probably benign
Transcript: ENSMUST00000145582
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152769
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155045
Meta Mutation Damage Score 0.1664 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (93/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains ten tandem zinc fingers and an N-terminal SET domain, so it is likely a DNA binding protein that interacts with other proteins. In adults, the encoded protein is expressed most highly in retina. Consequently, defects in this gene have been associated with familial exudative vitreoretinopathy (FEVR) and retinitis pigmentosa (RP). [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449I24Rik T A 5: 146,504,942 S300T possibly damaging Het
4932431P20Rik T C 7: 29,537,140 noncoding transcript Het
A2ml1 A C 6: 128,558,437 V770G probably damaging Het
Abca6 A G 11: 110,219,649 I558T probably benign Het
Abhd17c C A 7: 84,110,662 G295W probably damaging Het
Actn3 G A 19: 4,871,675 A159V probably damaging Het
Adgrv1 A T 13: 81,557,080 F1537Y probably damaging Het
Agbl1 G T 7: 76,419,880 V373F possibly damaging Het
Aldh1a1 A T 19: 20,642,915 E485D probably benign Het
Amdhd2 A G 17: 24,158,308 probably null Het
Armc3 A G 2: 19,201,811 D15G probably damaging Het
Atp2b2 A G 6: 113,760,650 L921P probably damaging Het
Btbd16 A G 7: 130,784,308 N88S probably benign Het
Capn10 T A 1: 92,938,034 C77* probably null Het
Caskin1 T C 17: 24,496,996 probably null Het
Catsper4 T C 4: 134,213,806 D254G probably benign Het
Catsperg1 T C 7: 29,185,040 D958G probably damaging Het
Ccar2 T G 14: 70,139,651 K787Q probably benign Het
Ccdc191 C T 16: 43,908,635 T244I probably benign Het
Cd33 A T 7: 43,530,275 L243Q possibly damaging Het
Cdc37 T C 9: 21,149,847 Y4C probably damaging Het
Cenpe T G 3: 135,239,780 N1018K probably benign Het
Crocc G A 4: 141,017,096 R1830C probably damaging Het
Csmd1 T C 8: 15,917,392 D3157G probably damaging Het
Dhx57 C T 17: 80,273,048 V492M probably damaging Het
Dnah2 A T 11: 69,458,185 I2486N probably benign Het
Dnhd1 C T 7: 105,693,721 T1424I possibly damaging Het
Dsc3 C T 18: 19,968,354 A661T probably benign Het
F930015N05Rik A G 11: 64,435,403 probably benign Het
Fbxo34 C A 14: 47,530,106 R308S probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Gm11595 A T 11: 99,772,501 C118S unknown Het
Gm9742 A T 13: 8,034,975 noncoding transcript Het
Gmeb2 G A 2: 181,259,049 A185V probably benign Het
Gpr15 A G 16: 58,718,255 V157A possibly damaging Het
Gpr3 C T 4: 133,210,621 A247T probably damaging Het
Grin2b A C 6: 135,778,700 S539A probably benign Het
Hmbs T C 9: 44,340,707 T92A probably benign Het
Inpp4a A G 1: 37,366,919 M173V probably benign Het
Irx4 T A 13: 73,265,476 S22T probably benign Het
Jph3 C T 8: 121,785,142 A623V probably benign Het
Kif1b G A 4: 149,187,640 S1568L possibly damaging Het
Ksr1 G A 11: 79,033,313 S361L probably damaging Het
Lyst T G 13: 13,635,262 Y506D probably damaging Het
Mctp1 A G 13: 76,824,822 D648G probably damaging Het
Megf8 T C 7: 25,364,582 S2788P possibly damaging Het
Mfsd2b T A 12: 4,867,659 Y129F probably benign Het
Mindy4 T C 6: 55,218,265 S155P probably benign Het
Mospd4 A G 18: 46,465,664 noncoding transcript Het
Myo18b A T 5: 112,831,078 L1223Q probably damaging Het
Nckipsd A G 9: 108,811,733 T156A probably benign Het
Ndst1 G A 18: 60,691,208 T799I probably benign Het
Npffr2 A T 5: 89,568,065 I84F probably damaging Het
Nphp3 G A 9: 104,008,243 V167M probably damaging Het
Nup107 C A 10: 117,774,475 R354L possibly damaging Het
Olfml2a T C 2: 38,941,687 C93R probably damaging Het
Olfr1145 A G 2: 87,810,341 I174V probably benign Het
Olfr1157 A T 2: 87,962,832 V20D probably benign Het
Olfr384 C G 11: 73,602,805 S75C possibly damaging Het
Pappa T A 4: 65,297,257 L1134M probably damaging Het
Plscr4 T G 9: 92,488,630 F217V possibly damaging Het
Pnpla8 T A 12: 44,308,057 Y667N probably benign Het
Polg A G 7: 79,464,928 L95P probably damaging Het
Psg20 T G 7: 18,682,718 I158L probably damaging Het
Pwwp2a A G 11: 43,705,318 S437G probably benign Het
Rdx A G 9: 52,069,732 M305V possibly damaging Het
Rinl A G 7: 28,796,743 E383G probably damaging Het
Ror1 A G 4: 100,442,093 M888V probably benign Het
Rps12 A T 10: 23,786,878 I22K possibly damaging Het
Rtca C A 3: 116,497,674 R219L possibly damaging Het
Ryr2 G A 13: 11,712,195 P2427S probably damaging Het
Slc10a6 A G 5: 103,609,056 Y281H probably benign Het
Slc39a11 A G 11: 113,369,803 S176P probably benign Het
Slfn10-ps A G 11: 83,030,342 noncoding transcript Het
Spef2 T C 15: 9,729,661 T124A possibly damaging Het
Sult2a4 G T 7: 13,915,260 P207Q probably damaging Het
Tas1r3 G A 4: 155,860,470 R765C probably damaging Het
Tcstv1 T C 13: 119,893,746 T117A probably damaging Het
Tha1 A G 11: 117,869,774 V208A probably damaging Het
Tmbim4 T A 10: 120,224,753 I215N probably damaging Het
Tmem202 T A 9: 59,520,200 I122F probably benign Het
Tomm70a T C 16: 57,121,871 S4P unknown Het
Tpcn2 A G 7: 145,273,975 probably benign Het
Trim36 A T 18: 46,212,337 F10I probably benign Het
Usp30 A G 5: 114,111,163 E176G probably damaging Het
Usp8 T G 2: 126,737,575 probably null Het
Vmn1r32 T A 6: 66,553,549 Y81F probably benign Het
Vps36 G T 8: 22,218,289 probably null Het
Wnt3 A G 11: 103,812,648 H319R possibly damaging Het
Zfp319 A T 8: 95,323,763 probably benign Het
Zfp799 C T 17: 32,819,498 R598Q possibly damaging Het
Zfp831 T C 2: 174,648,124 V1228A probably benign Het
Zfp938 T C 10: 82,226,042 D248G probably benign Het
Other mutations in Zfp408
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01154:Zfp408 APN 2 91648006 splice site probably benign
IGL02374:Zfp408 APN 2 91645811 missense probably damaging 1.00
IGL03012:Zfp408 APN 2 91647808 missense probably benign
Innuendo UTSW 2 91646345 missense probably benign 0.06
Slander UTSW 2 91647849 splice site probably benign
R0467:Zfp408 UTSW 2 91645537 missense possibly damaging 0.86
R0981:Zfp408 UTSW 2 91645183 missense probably benign 0.38
R1579:Zfp408 UTSW 2 91646128 missense probably benign 0.05
R1673:Zfp408 UTSW 2 91646008 missense probably damaging 0.97
R1935:Zfp408 UTSW 2 91649748 start codon destroyed probably null 0.95
R2071:Zfp408 UTSW 2 91646018 missense probably damaging 0.96
R2141:Zfp408 UTSW 2 91647849 splice site probably benign
R3688:Zfp408 UTSW 2 91646432 missense probably benign 0.00
R4681:Zfp408 UTSW 2 91645786 missense probably damaging 1.00
R4782:Zfp408 UTSW 2 91645024 missense possibly damaging 0.88
R4939:Zfp408 UTSW 2 91645105 missense probably damaging 1.00
R5306:Zfp408 UTSW 2 91646345 missense probably benign 0.06
R5344:Zfp408 UTSW 2 91645243 missense probably benign 0.15
R6054:Zfp408 UTSW 2 91649291 missense probably benign 0.00
Z1176:Zfp408 UTSW 2 91647805 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGCTCTTGCAGGGGTAAAGG -3'
(R):5'- TTACACACTGGCCACCAAGTTG -3'

Sequencing Primer
(F):5'- CGTCAGGTGCCTGCTTCTG -3'
(R):5'- GCCACCAAGTTGCGCCG -3'
Posted On2014-09-17