Mutagenetix > Incidental Mutations

Incidental Mutation 'R2127:Usp8'

227589

Institutional Source

Beutler Lab

Gene Symbol

Usp8

Ensembl Gene

ENSMUSG00000027363

Gene Name

ubiquitin specific peptidase 8

Synonyms

Ubpy

MMRRC Submission

040130-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2127 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

126707328-126759297 bp(+) (GRCm38)

Type of Mutation

splice site (20 bp from exon)

DNA Base Change (assembly)

T to G at 126737575 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000106046 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028841] [ENSMUST00000110416] [ENSMUST00000136319]

Predicted Effect

probably null
Transcript: ENSMUST00000028841

SMART Domains

Protein: ENSMUSP00000028841
Gene: ENSMUSG00000027363

Domain	Start	End	E-Value	Type
Pfam:USP8_dimer	6	116	2.3e-37	PFAM
low complexity region	119	140	N/A	INTRINSIC
RHOD	185	310	3.69e-7	SMART
low complexity region	378	393	N/A	INTRINSIC
coiled coil region	467	501	N/A	INTRINSIC
low complexity region	642	657	N/A	INTRINSIC
Pfam:UCH	738	1068	4e-88	PFAM
Pfam:UCH_1	739	1053	1.9e-29	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000110416

SMART Domains

Protein: ENSMUSP00000106046
Gene: ENSMUSG00000027363

Domain	Start	End	E-Value	Type
Pfam:USP8_dimer	6	127	2.5e-36	PFAM
low complexity region	130	151	N/A	INTRINSIC
RHOD	196	321	3.69e-7	SMART
low complexity region	389	404	N/A	INTRINSIC
coiled coil region	478	512	N/A	INTRINSIC
low complexity region	653	668	N/A	INTRINSIC
Pfam:UCH	749	1079	1.3e-82	PFAM
Pfam:UCH_1	750	1064	3.7e-27	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000136319

SMART Domains

Protein: ENSMUSP00000121578
Gene: ENSMUSG00000027364

Domain	Start	End	E-Value	Type
Pfam:UCH	1	268	1.9e-39	PFAM
Pfam:UCH_1	1	269	1.3e-14	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138859

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

98% (93/95)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the ubiquitin-specific processing protease family of proteins. The encoded protein is thought to regulate the morphology of the endosome by ubiquitination of proteins on this organelle and is involved in cargo sorting and membrane trafficking at the early endosome stage. This protein is required for the cell to enter the S phase of the cell cycle and also functions as a positive regulator in the Hedgehog signaling pathway in development. Pseudogenes of this gene are present on chromosomes 2 and 6. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
PHENOTYPE: Embryos homozygous for a knock-out allele appear severely growth retarded and disorganized at E9.5 and die in utero due to ventral-folding defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930449I24Rik	T	A	5: 146,504,942	S300T	possibly damaging	Het
4932431P20Rik	T	C	7: 29,537,140		noncoding transcript	Het
A2ml1	A	C	6: 128,558,437	V770G	probably damaging	Het
Abca6	A	G	11: 110,219,649	I558T	probably benign	Het
Abhd17c	C	A	7: 84,110,662	G295W	probably damaging	Het
Actn3	G	A	19: 4,871,675	A159V	probably damaging	Het
Adgrv1	A	T	13: 81,557,080	F1537Y	probably damaging	Het
Agbl1	G	T	7: 76,419,880	V373F	possibly damaging	Het
Aldh1a1	A	T	19: 20,642,915	E485D	probably benign	Het
Amdhd2	A	G	17: 24,158,308		probably null	Het
Armc3	A	G	2: 19,201,811	D15G	probably damaging	Het
Atp2b2	A	G	6: 113,760,650	L921P	probably damaging	Het
Btbd16	A	G	7: 130,784,308	N88S	probably benign	Het
Capn10	T	A	1: 92,938,034	C77*	probably null	Het
Caskin1	T	C	17: 24,496,996		probably null	Het
Catsper4	T	C	4: 134,213,806	D254G	probably benign	Het
Catsperg1	T	C	7: 29,185,040	D958G	probably damaging	Het
Ccar2	T	G	14: 70,139,651	K787Q	probably benign	Het
Ccdc191	C	T	16: 43,908,635	T244I	probably benign	Het
Cd33	A	T	7: 43,530,275	L243Q	possibly damaging	Het
Cdc37	T	C	9: 21,149,847	Y4C	probably damaging	Het
Cenpe	T	G	3: 135,239,780	N1018K	probably benign	Het
Crocc	G	A	4: 141,017,096	R1830C	probably damaging	Het
Csmd1	T	C	8: 15,917,392	D3157G	probably damaging	Het
Dhx57	C	T	17: 80,273,048	V492M	probably damaging	Het
Dnah2	A	T	11: 69,458,185	I2486N	probably benign	Het
Dnhd1	C	T	7: 105,693,721	T1424I	possibly damaging	Het
Dsc3	C	T	18: 19,968,354	A661T	probably benign	Het
F930015N05Rik	A	G	11: 64,435,403		probably benign	Het
Fbxo34	C	A	14: 47,530,106	R308S	probably damaging	Het
Gm10608	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	9: 119,160,716		probably benign	Het
Gm11595	A	T	11: 99,772,501	C118S	unknown	Het
Gm9742	A	T	13: 8,034,975		noncoding transcript	Het
Gmeb2	G	A	2: 181,259,049	A185V	probably benign	Het
Gpr15	A	G	16: 58,718,255	V157A	possibly damaging	Het
Gpr3	C	T	4: 133,210,621	A247T	probably damaging	Het
Grin2b	A	C	6: 135,778,700	S539A	probably benign	Het
Hmbs	T	C	9: 44,340,707	T92A	probably benign	Het
Inpp4a	A	G	1: 37,366,919	M173V	probably benign	Het
Irx4	T	A	13: 73,265,476	S22T	probably benign	Het
Jph3	C	T	8: 121,785,142	A623V	probably benign	Het
Kif1b	G	A	4: 149,187,640	S1568L	possibly damaging	Het
Ksr1	G	A	11: 79,033,313	S361L	probably damaging	Het
Lyst	T	G	13: 13,635,262	Y506D	probably damaging	Het
Mctp1	A	G	13: 76,824,822	D648G	probably damaging	Het
Megf8	T	C	7: 25,364,582	S2788P	possibly damaging	Het
Mfsd2b	T	A	12: 4,867,659	Y129F	probably benign	Het
Mindy4	T	C	6: 55,218,265	S155P	probably benign	Het
Mospd4	A	G	18: 46,465,664		noncoding transcript	Het
Myo18b	A	T	5: 112,831,078	L1223Q	probably damaging	Het
Nckipsd	A	G	9: 108,811,733	T156A	probably benign	Het
Ndst1	G	A	18: 60,691,208	T799I	probably benign	Het
Npffr2	A	T	5: 89,568,065	I84F	probably damaging	Het
Nphp3	G	A	9: 104,008,243	V167M	probably damaging	Het
Nup107	C	A	10: 117,774,475	R354L	possibly damaging	Het
Olfml2a	T	C	2: 38,941,687	C93R	probably damaging	Het
Olfr1145	A	G	2: 87,810,341	I174V	probably benign	Het
Olfr1157	A	T	2: 87,962,832	V20D	probably benign	Het
Olfr384	C	G	11: 73,602,805	S75C	possibly damaging	Het
Pappa	T	A	4: 65,297,257	L1134M	probably damaging	Het
Plscr4	T	G	9: 92,488,630	F217V	possibly damaging	Het
Pnpla8	T	A	12: 44,308,057	Y667N	probably benign	Het
Polg	A	G	7: 79,464,928	L95P	probably damaging	Het
Psg20	T	G	7: 18,682,718	I158L	probably damaging	Het
Pwwp2a	A	G	11: 43,705,318	S437G	probably benign	Het
Rdx	A	G	9: 52,069,732	M305V	possibly damaging	Het
Rinl	A	G	7: 28,796,743	E383G	probably damaging	Het
Ror1	A	G	4: 100,442,093	M888V	probably benign	Het
Rps12	A	T	10: 23,786,878	I22K	possibly damaging	Het
Rtca	C	A	3: 116,497,674	R219L	possibly damaging	Het
Ryr2	G	A	13: 11,712,195	P2427S	probably damaging	Het
Slc10a6	A	G	5: 103,609,056	Y281H	probably benign	Het
Slc39a11	A	G	11: 113,369,803	S176P	probably benign	Het
Slfn10-ps	A	G	11: 83,030,342		noncoding transcript	Het
Spef2	T	C	15: 9,729,661	T124A	possibly damaging	Het
Sult2a4	G	T	7: 13,915,260	P207Q	probably damaging	Het
Tas1r3	G	A	4: 155,860,470	R765C	probably damaging	Het
Tcstv1	T	C	13: 119,893,746	T117A	probably damaging	Het
Tha1	A	G	11: 117,869,774	V208A	probably damaging	Het
Tmbim4	T	A	10: 120,224,753	I215N	probably damaging	Het
Tmem202	T	A	9: 59,520,200	I122F	probably benign	Het
Tomm70a	T	C	16: 57,121,871	S4P	unknown	Het
Tpcn2	A	G	7: 145,273,975		probably benign	Het
Trim36	A	T	18: 46,212,337	F10I	probably benign	Het
Usp30	A	G	5: 114,111,163	E176G	probably damaging	Het
Vmn1r32	T	A	6: 66,553,549	Y81F	probably benign	Het
Vps36	G	T	8: 22,218,289		probably null	Het
Wnt3	A	G	11: 103,812,648	H319R	possibly damaging	Het
Zfp319	A	T	8: 95,323,763		probably benign	Het
Zfp408	T	C	2: 91,645,174	E545G	probably damaging	Het
Zfp799	C	T	17: 32,819,498	R598Q	possibly damaging	Het
Zfp831	T	C	2: 174,648,124	V1228A	probably benign	Het
Zfp938	T	C	10: 82,226,042	D248G	probably benign	Het

Other mutations in Usp8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00553:Usp8	APN	2	126758560	missense	probably damaging	1.00
IGL00771:Usp8	APN	2	126725433	splice site	probably null
IGL01073:Usp8	APN	2	126718114	missense	probably damaging	0.96
IGL01722:Usp8	APN	2	126758152	missense	probably damaging	1.00
IGL02100:Usp8	APN	2	126737854	intron	probably benign
IGL02210:Usp8	APN	2	126718056	intron	probably benign
IGL02516:Usp8	APN	2	126742174	missense	probably benign	0.00
IGL02743:Usp8	APN	2	126734023	missense	probably damaging	1.00
IGL02953:Usp8	APN	2	126737937	missense	probably benign
satsuke	UTSW	2	126751111	missense	probably damaging	1.00
R0045:Usp8	UTSW	2	126742223	missense	probably benign	0.03
R0048:Usp8	UTSW	2	126737889	missense	probably damaging	0.96
R0048:Usp8	UTSW	2	126737889	missense	probably damaging	0.96
R0143:Usp8	UTSW	2	126755089	intron	probably benign
R0427:Usp8	UTSW	2	126718032	intron	probably benign
R0440:Usp8	UTSW	2	126725390	missense	probably benign	0.00
R0636:Usp8	UTSW	2	126720110	missense	possibly damaging	0.87
R0828:Usp8	UTSW	2	126742114	intron	probably benign
R1468:Usp8	UTSW	2	126754927	missense	probably damaging	1.00
R1468:Usp8	UTSW	2	126754927	missense	probably damaging	1.00
R1782:Usp8	UTSW	2	126720051	missense	probably damaging	1.00
R1860:Usp8	UTSW	2	126756040	missense	probably damaging	1.00
R2259:Usp8	UTSW	2	126758568	missense	probably benign	0.32
R2892:Usp8	UTSW	2	126758155	missense	probably damaging	1.00
R2893:Usp8	UTSW	2	126758155	missense	probably damaging	1.00
R3104:Usp8	UTSW	2	126758512	missense	probably damaging	1.00
R4074:Usp8	UTSW	2	126752370	missense	probably damaging	1.00
R4678:Usp8	UTSW	2	126725429	missense	probably null	1.00
R4715:Usp8	UTSW	2	126729222	missense	possibly damaging	0.80
R4832:Usp8	UTSW	2	126755038	missense	probably damaging	1.00
R4914:Usp8	UTSW	2	126720140	nonsense	probably null
R4915:Usp8	UTSW	2	126720140	nonsense	probably null
R4918:Usp8	UTSW	2	126720140	nonsense	probably null
R5262:Usp8	UTSW	2	126751111	missense	probably damaging	1.00
R5625:Usp8	UTSW	2	126742277	missense	probably damaging	1.00
R5667:Usp8	UTSW	2	126742425	missense	probably benign	0.00
R5671:Usp8	UTSW	2	126742425	missense	probably benign	0.00
R5984:Usp8	UTSW	2	126742481	missense	probably benign	0.10
R6529:Usp8	UTSW	2	126725378	missense	probably benign	0.01
R6551:Usp8	UTSW	2	126733182	intron	probably benign
R6885:Usp8	UTSW	2	126752310	missense	probably damaging	1.00
R7768:Usp8	UTSW	2	126751123	missense	probably damaging	1.00
R8097:Usp8	UTSW	2	126754880	missense	probably benign	0.44
R8130:Usp8	UTSW	2	126717998	intron	probably benign
R8379:Usp8	UTSW	2	126742571	missense	probably benign
R8412:Usp8	UTSW	2	126742658	missense	probably benign
R8880:Usp8	UTSW	2	126748309	missense	probably damaging	1.00
Z1177:Usp8	UTSW	2	126758431	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTTGCTGTCAAGAGACTGTCC -3'
(R):5'- AAGGGCAATCACCACTGTC -3'

Sequencing Primer
(F):5'- GTCAAGAGACTGTCCCGTCTTAAAG -3'
(R):5'- GGGCAATCACCACTGTCTTAAAG -3'

Posted On

2014-09-17