Incidental Mutation 'R0149:Myo7b'
ID 22760
Institutional Source Beutler Lab
Gene Symbol Myo7b
Ensembl Gene ENSMUSG00000024388
Gene Name myosin VIIB
Synonyms
MMRRC Submission 038433-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0149 (G1)
Quality Score 225
Status Validated (trace)
Chromosome 18
Chromosomal Location 32092287-32169984 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 32147262 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 94 (I94F)
Ref Sequence ENSEMBL: ENSMUSP00000118046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000134663]
AlphaFold Q99MZ6
Predicted Effect probably damaging
Transcript: ENSMUST00000134663
AA Change: I94F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118046
Gene: ENSMUSG00000024388
AA Change: I94F

DomainStartEndE-ValueType
MYSc 59 761 N/A SMART
IQ 762 784 1.07e-1 SMART
IQ 785 807 7.01e-6 SMART
IQ 831 853 4.93e-1 SMART
IQ 854 876 1.63e-1 SMART
MyTH4 989 1189 1.14e-71 SMART
B41 1190 1409 3.66e-16 SMART
SH3 1501 1563 3.25e-7 SMART
MyTH4 1641 1790 7.66e-55 SMART
B41 1792 2009 8.19e-28 SMART
Meta Mutation Damage Score 0.4971 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency 97% (84/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found in brush border microvilli of epithelial cells in the intestines and kidneys. The encoded protein is involved in linking protocadherins to the actin cytoskeleton and is essential for proper microvilli function. This protein aids in the accumulation of intermicrovillar adhesion components such as harmonin and ANKS4B, and this accumulation is necessary for normal brush border action. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A230072I06Rik A C 8: 12,330,000 (GRCm39) S152R unknown Het
Acsbg2 A G 17: 57,160,924 (GRCm39) probably benign Het
Adam6a G T 12: 113,509,369 (GRCm39) V581F probably damaging Het
Adgrl3 A T 5: 81,908,544 (GRCm39) I1165F probably damaging Het
Aldh1l1 A G 6: 90,566,396 (GRCm39) K656E possibly damaging Het
Ankhd1 T C 18: 36,780,267 (GRCm39) I1773T probably damaging Het
Api5 A T 2: 94,253,842 (GRCm39) L287* probably null Het
Ascc3 A T 10: 50,484,089 (GRCm39) N55I probably benign Het
Cav1 C A 6: 17,339,352 (GRCm39) R146S possibly damaging Het
Cdhr2 A T 13: 54,881,820 (GRCm39) I1118F probably damaging Het
Cemip A G 7: 83,613,218 (GRCm39) I660T probably benign Het
Clk1 T A 1: 58,453,760 (GRCm39) N305Y probably damaging Het
Cux1 T A 5: 136,308,351 (GRCm39) I1263F probably damaging Het
Cyp2d26 A G 15: 82,676,968 (GRCm39) L152P probably damaging Het
Dmtf1 A G 5: 9,182,571 (GRCm39) S188P probably damaging Het
Dock2 A G 11: 34,388,327 (GRCm39) L202P probably damaging Het
Dscaml1 T G 9: 45,653,978 (GRCm39) Y1418* probably null Het
Efemp2 A T 19: 5,527,988 (GRCm39) H107L probably damaging Het
Eng T C 2: 32,562,397 (GRCm39) probably null Het
Erc1 A T 6: 119,801,791 (GRCm39) S75R probably damaging Het
Fgl2 A T 5: 21,580,783 (GRCm39) D375V probably damaging Het
Fpr-rs6 T C 17: 20,402,475 (GRCm39) I295M probably benign Het
Fsip2 T C 2: 82,805,849 (GRCm39) S723P possibly damaging Het
Gdpd5 A G 7: 99,107,997 (GRCm39) I530V possibly damaging Het
Gm15217 T A 14: 46,617,841 (GRCm39) probably benign Het
Gm4922 T C 10: 18,659,289 (GRCm39) T478A probably benign Het
Gmcl1 A T 6: 86,709,891 (GRCm39) probably null Het
Has1 T C 17: 18,070,433 (GRCm39) T163A probably damaging Het
Hmcn1 A T 1: 150,553,075 (GRCm39) N2538K probably benign Het
Itga2 A G 13: 114,973,115 (GRCm39) probably benign Het
Kcnip1 A T 11: 33,793,177 (GRCm39) M5K probably benign Het
Kcnk4 T C 19: 6,903,562 (GRCm39) E329G probably benign Het
Kcnt1 T C 2: 25,788,276 (GRCm39) probably benign Het
Klkb1 A G 8: 45,729,100 (GRCm39) C375R probably damaging Het
Loxl2 C A 14: 69,930,527 (GRCm39) H764N probably benign Het
Lrrc55 A T 2: 85,026,589 (GRCm39) M145K probably damaging Het
Lrrtm2 A G 18: 35,345,985 (GRCm39) I439T probably benign Het
Magi1 A T 6: 93,724,226 (GRCm39) I263N probably damaging Het
Map4 C T 9: 109,896,692 (GRCm39) P641L probably damaging Het
Mars1 A T 10: 127,135,903 (GRCm39) N558K probably damaging Het
Mfap2 A G 4: 140,742,294 (GRCm39) D98G probably damaging Het
Mgat5b A G 11: 116,875,965 (GRCm39) probably benign Het
Mki67 A T 7: 135,300,153 (GRCm39) V1627D probably benign Het
Mtnr1a A T 8: 45,522,352 (GRCm39) I36F probably benign Het
Myh15 A T 16: 48,934,368 (GRCm39) N645I probably benign Het
Nefh A T 11: 4,890,799 (GRCm39) S607T probably benign Het
Ngf T A 3: 102,427,762 (GRCm39) H174Q probably benign Het
Noa1 G A 5: 77,445,020 (GRCm39) Q600* probably null Het
Nr2f2 A G 7: 70,007,810 (GRCm39) V71A possibly damaging Het
Oas2 A T 5: 120,876,466 (GRCm39) F492L probably damaging Het
Or2y17 A T 11: 49,231,641 (GRCm39) Y94F probably benign Het
Or8g21 T A 9: 38,905,880 (GRCm39) M284L probably benign Het
Osmr A G 15: 6,871,432 (GRCm39) probably null Het
P4ha1 A G 10: 59,184,221 (GRCm39) T228A probably damaging Het
Pip5kl1 T C 2: 32,468,966 (GRCm39) V195A possibly damaging Het
Plagl2 A T 2: 153,073,523 (GRCm39) D459E probably benign Het
Plxna1 T C 6: 89,297,595 (GRCm39) E1863G probably null Het
Prdm10 T G 9: 31,227,455 (GRCm39) probably benign Het
Prr14l A C 5: 32,950,985 (GRCm39) L1936R probably damaging Het
Rgs1 T C 1: 144,124,825 (GRCm39) probably benign Het
Rgsl1 A G 1: 153,669,510 (GRCm39) F292S probably damaging Het
Rhobtb2 T C 14: 70,033,357 (GRCm39) T538A probably benign Het
Rictor A G 15: 6,813,588 (GRCm39) N1025D possibly damaging Het
Rsph10b T A 5: 143,875,727 (GRCm39) probably benign Het
Rwdd4a A G 8: 47,997,255 (GRCm39) D158G probably null Het
Sdk1 T C 5: 141,842,809 (GRCm39) probably benign Het
Serpina3n A C 12: 104,377,635 (GRCm39) K296T probably benign Het
Slco1a8 T C 6: 141,938,203 (GRCm39) T239A probably benign Het
Snw1 A G 12: 87,508,687 (GRCm39) V124A possibly damaging Het
Tas2r140 T G 6: 40,468,232 (GRCm39) F21V probably benign Het
Tmc6 G A 11: 117,660,274 (GRCm39) L655F probably damaging Het
Tmem260 A T 14: 48,689,504 (GRCm39) T108S possibly damaging Het
Trim2 T C 3: 84,098,083 (GRCm39) Y406C probably damaging Het
Tsc1 T C 2: 28,560,913 (GRCm39) I257T probably damaging Het
Ttn T C 2: 76,673,746 (GRCm39) probably benign Het
Unc80 T A 1: 66,560,760 (GRCm39) N829K possibly damaging Het
Vmn1r235 A C 17: 21,482,257 (GRCm39) D194A probably damaging Het
Vmn2r100 A T 17: 19,741,509 (GRCm39) probably null Het
Ylpm1 G T 12: 85,075,612 (GRCm39) R321L probably damaging Het
Zan T C 5: 137,395,028 (GRCm39) T4381A unknown Het
Zfp457 A G 13: 67,440,710 (GRCm39) F622L probably damaging Het
Zfy1 T C Y: 726,121 (GRCm39) H548R possibly damaging Het
Zmym4 A T 4: 126,804,938 (GRCm39) S441T probably benign Het
Other mutations in Myo7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Myo7b APN 18 32,154,609 (GRCm39) utr 5 prime probably benign
IGL01799:Myo7b APN 18 32,095,823 (GRCm39) missense probably damaging 1.00
IGL01881:Myo7b APN 18 32,133,320 (GRCm39) splice site probably benign
IGL01883:Myo7b APN 18 32,131,204 (GRCm39) missense probably damaging 1.00
IGL01934:Myo7b APN 18 32,134,394 (GRCm39) critical splice donor site probably null
IGL01980:Myo7b APN 18 32,094,953 (GRCm39) missense possibly damaging 0.86
IGL02506:Myo7b APN 18 32,100,207 (GRCm39) missense probably damaging 1.00
IGL02704:Myo7b APN 18 32,100,014 (GRCm39) missense probably benign 0.13
IGL02929:Myo7b APN 18 32,127,978 (GRCm39) missense probably benign 0.19
IGL03149:Myo7b APN 18 32,147,355 (GRCm39) missense probably damaging 1.00
IGL03335:Myo7b APN 18 32,118,073 (GRCm39) missense possibly damaging 0.81
IGL03372:Myo7b APN 18 32,131,654 (GRCm39) missense probably damaging 1.00
IGL03385:Myo7b APN 18 32,122,630 (GRCm39) missense probably benign 0.00
PIT4131001:Myo7b UTSW 18 32,094,259 (GRCm39) missense probably benign 0.17
PIT4445001:Myo7b UTSW 18 32,095,405 (GRCm39) missense probably damaging 0.96
PIT4445001:Myo7b UTSW 18 32,092,519 (GRCm39) missense possibly damaging 0.80
R0034:Myo7b UTSW 18 32,093,913 (GRCm39) missense probably damaging 1.00
R0138:Myo7b UTSW 18 32,143,204 (GRCm39) missense probably damaging 1.00
R0226:Myo7b UTSW 18 32,105,949 (GRCm39) missense probably benign 0.00
R0312:Myo7b UTSW 18 32,147,390 (GRCm39) missense possibly damaging 0.68
R0361:Myo7b UTSW 18 32,147,262 (GRCm39) missense probably damaging 1.00
R0506:Myo7b UTSW 18 32,097,439 (GRCm39) critical splice donor site probably null
R0524:Myo7b UTSW 18 32,146,477 (GRCm39) missense possibly damaging 0.91
R0645:Myo7b UTSW 18 32,127,962 (GRCm39) missense probably benign 0.10
R0724:Myo7b UTSW 18 32,138,602 (GRCm39) splice site probably benign
R0731:Myo7b UTSW 18 32,094,878 (GRCm39) splice site probably null
R0762:Myo7b UTSW 18 32,116,997 (GRCm39) missense probably benign 0.01
R0843:Myo7b UTSW 18 32,107,137 (GRCm39) missense possibly damaging 0.83
R0894:Myo7b UTSW 18 32,133,123 (GRCm39) missense probably damaging 1.00
R0966:Myo7b UTSW 18 32,131,816 (GRCm39) missense probably damaging 1.00
R1205:Myo7b UTSW 18 32,127,395 (GRCm39) missense probably damaging 1.00
R1387:Myo7b UTSW 18 32,116,805 (GRCm39) splice site probably benign
R1523:Myo7b UTSW 18 32,099,929 (GRCm39) missense probably damaging 1.00
R1544:Myo7b UTSW 18 32,127,962 (GRCm39) missense probably benign 0.10
R1623:Myo7b UTSW 18 32,133,104 (GRCm39) missense probably damaging 1.00
R1780:Myo7b UTSW 18 32,094,238 (GRCm39) missense probably damaging 1.00
R1785:Myo7b UTSW 18 32,127,950 (GRCm39) missense probably benign
R1786:Myo7b UTSW 18 32,127,950 (GRCm39) missense probably benign
R1796:Myo7b UTSW 18 32,119,728 (GRCm39) missense possibly damaging 0.93
R1907:Myo7b UTSW 18 32,110,052 (GRCm39) missense possibly damaging 0.89
R2027:Myo7b UTSW 18 32,118,013 (GRCm39) missense probably benign
R2102:Myo7b UTSW 18 32,133,031 (GRCm39) missense probably damaging 1.00
R2174:Myo7b UTSW 18 32,116,610 (GRCm39) missense probably damaging 1.00
R2272:Myo7b UTSW 18 32,110,096 (GRCm39) missense probably benign 0.41
R2323:Myo7b UTSW 18 32,104,398 (GRCm39) missense probably damaging 1.00
R2365:Myo7b UTSW 18 32,147,384 (GRCm39) missense probably damaging 0.98
R3078:Myo7b UTSW 18 32,100,237 (GRCm39) missense probably benign 0.04
R3522:Myo7b UTSW 18 32,143,132 (GRCm39) missense probably damaging 1.00
R3788:Myo7b UTSW 18 32,107,165 (GRCm39) missense possibly damaging 0.95
R3880:Myo7b UTSW 18 32,102,567 (GRCm39) missense probably damaging 0.96
R4334:Myo7b UTSW 18 32,110,040 (GRCm39) missense probably damaging 1.00
R4343:Myo7b UTSW 18 32,116,680 (GRCm39) missense probably damaging 1.00
R4497:Myo7b UTSW 18 32,147,282 (GRCm39) missense probably benign 0.06
R4498:Myo7b UTSW 18 32,147,282 (GRCm39) missense probably benign 0.06
R4551:Myo7b UTSW 18 32,118,161 (GRCm39) missense probably benign 0.01
R4593:Myo7b UTSW 18 32,146,428 (GRCm39) missense possibly damaging 0.77
R4616:Myo7b UTSW 18 32,136,540 (GRCm39) splice site probably null
R4646:Myo7b UTSW 18 32,127,422 (GRCm39) missense probably benign 0.25
R4648:Myo7b UTSW 18 32,100,178 (GRCm39) splice site probably null
R4737:Myo7b UTSW 18 32,131,655 (GRCm39) missense probably damaging 1.00
R4765:Myo7b UTSW 18 32,094,953 (GRCm39) missense probably benign 0.00
R4790:Myo7b UTSW 18 32,133,158 (GRCm39) splice site probably null
R4909:Myo7b UTSW 18 32,097,489 (GRCm39) missense probably benign 0.01
R5027:Myo7b UTSW 18 32,108,265 (GRCm39) missense probably benign 0.22
R5034:Myo7b UTSW 18 32,104,440 (GRCm39) missense probably damaging 1.00
R5112:Myo7b UTSW 18 32,116,640 (GRCm39) missense probably damaging 1.00
R5266:Myo7b UTSW 18 32,131,787 (GRCm39) missense probably damaging 1.00
R5267:Myo7b UTSW 18 32,131,787 (GRCm39) missense probably damaging 1.00
R5348:Myo7b UTSW 18 32,116,972 (GRCm39) missense probably damaging 0.96
R5457:Myo7b UTSW 18 32,104,503 (GRCm39) splice site probably null
R5540:Myo7b UTSW 18 32,140,143 (GRCm39) missense probably damaging 1.00
R5628:Myo7b UTSW 18 32,107,240 (GRCm39) missense probably benign
R5815:Myo7b UTSW 18 32,099,341 (GRCm39) missense probably damaging 1.00
R6062:Myo7b UTSW 18 32,101,043 (GRCm39) missense possibly damaging 0.94
R6137:Myo7b UTSW 18 32,133,027 (GRCm39) missense probably damaging 1.00
R6158:Myo7b UTSW 18 32,121,602 (GRCm39) missense probably benign 0.00
R6218:Myo7b UTSW 18 32,092,507 (GRCm39) missense probably benign 0.10
R6256:Myo7b UTSW 18 32,116,748 (GRCm39) missense probably damaging 1.00
R6257:Myo7b UTSW 18 32,146,468 (GRCm39) missense probably damaging 1.00
R6265:Myo7b UTSW 18 32,131,203 (GRCm39) missense probably damaging 1.00
R6302:Myo7b UTSW 18 32,127,439 (GRCm39) missense probably damaging 0.98
R6438:Myo7b UTSW 18 32,099,382 (GRCm39) missense probably damaging 1.00
R6654:Myo7b UTSW 18 32,123,322 (GRCm39) missense possibly damaging 0.46
R7030:Myo7b UTSW 18 32,104,626 (GRCm39) missense probably damaging 1.00
R7090:Myo7b UTSW 18 32,131,765 (GRCm39) missense probably damaging 1.00
R7210:Myo7b UTSW 18 32,140,155 (GRCm39) missense probably damaging 1.00
R7218:Myo7b UTSW 18 32,114,054 (GRCm39) missense probably benign 0.05
R7378:Myo7b UTSW 18 32,099,292 (GRCm39) missense probably damaging 1.00
R7458:Myo7b UTSW 18 32,121,604 (GRCm39) missense possibly damaging 0.89
R7517:Myo7b UTSW 18 32,146,320 (GRCm39) missense probably damaging 0.99
R7559:Myo7b UTSW 18 32,116,413 (GRCm39) missense probably benign 0.01
R7667:Myo7b UTSW 18 32,094,958 (GRCm39) missense probably benign
R7737:Myo7b UTSW 18 32,147,257 (GRCm39) nonsense probably null
R7942:Myo7b UTSW 18 32,146,422 (GRCm39) missense probably damaging 0.98
R8030:Myo7b UTSW 18 32,131,135 (GRCm39) missense probably damaging 0.96
R8114:Myo7b UTSW 18 32,098,677 (GRCm39) missense probably damaging 1.00
R8338:Myo7b UTSW 18 32,104,408 (GRCm39) missense probably damaging 0.96
R8341:Myo7b UTSW 18 32,116,979 (GRCm39) missense probably benign 0.39
R8406:Myo7b UTSW 18 32,092,866 (GRCm39) missense probably damaging 1.00
R8464:Myo7b UTSW 18 32,095,757 (GRCm39) missense probably benign 0.00
R8517:Myo7b UTSW 18 32,100,244 (GRCm39) missense possibly damaging 0.87
R8537:Myo7b UTSW 18 32,110,142 (GRCm39) missense probably benign 0.08
R8546:Myo7b UTSW 18 32,123,201 (GRCm39) missense probably benign 0.19
R8721:Myo7b UTSW 18 32,140,064 (GRCm39) missense probably damaging 1.00
R8770:Myo7b UTSW 18 32,114,124 (GRCm39) missense probably benign 0.03
R8841:Myo7b UTSW 18 32,097,490 (GRCm39) missense probably benign 0.06
R8853:Myo7b UTSW 18 32,119,744 (GRCm39) missense possibly damaging 0.67
R8960:Myo7b UTSW 18 32,127,299 (GRCm39) splice site probably benign
R8984:Myo7b UTSW 18 32,099,402 (GRCm39) missense probably null 0.68
R9356:Myo7b UTSW 18 32,110,096 (GRCm39) missense probably damaging 1.00
R9357:Myo7b UTSW 18 32,093,129 (GRCm39) missense probably damaging 1.00
R9364:Myo7b UTSW 18 32,133,413 (GRCm39) missense probably benign 0.12
R9405:Myo7b UTSW 18 32,109,356 (GRCm39) missense probably benign 0.00
R9533:Myo7b UTSW 18 32,108,297 (GRCm39) missense probably benign 0.27
R9776:Myo7b UTSW 18 32,133,068 (GRCm39) missense probably benign 0.45
X0027:Myo7b UTSW 18 32,098,689 (GRCm39) missense probably damaging 1.00
Z1176:Myo7b UTSW 18 32,114,051 (GRCm39) missense possibly damaging 0.82
Z1177:Myo7b UTSW 18 32,118,109 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGGTTGCCCAGCACAAAGAG -3'
(R):5'- GAGAGTTGGTGACTGTCATTCCAGG -3'

Sequencing Primer
(F):5'- gccagcacttattgactatctac -3'
(R):5'- TGACTGTCATTCCAGGAACACTG -3'
Posted On 2013-04-16