Mutagenetix > Incidental Mutation

Incidental Mutation 'R2127:Grin2b'

227612

Institutional Source

Beutler Lab

Gene Symbol

Grin2b

Ensembl Gene

ENSMUSG00000030209

Gene Name

glutamate receptor, ionotropic, NMDA2B (epsilon 2)

Synonyms

GluRepsilon2, NMDAR2B, GluN2B, Nmdar2b, NR2B

MMRRC Submission

040130-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2127 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

135713233-136173511 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 135778700 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Alanine at position 539 (S539A)

Ref Sequence

ENSEMBL: ENSMUSP00000107536 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053880] [ENSMUST00000111905]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000053880
AA Change: S539A

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000062284
Gene: ENSMUSG00000030209
AA Change: S539A

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Pfam:ANF_receptor	106	306	8.6e-10	PFAM
PBPe	431	799	1.06e-67	SMART
Lig_chan-Glu_bd	440	503	1.82e-22	SMART
Pfam:NMDAR2_C	840	1482	4.8e-270	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000111905
AA Change: S539A

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000107536
Gene: ENSMUSG00000030209
AA Change: S539A

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Pfam:ANF_receptor	56	307	4.2e-10	PFAM
PBPe	431	799	1.06e-67	SMART
Lig_chan-Glu_bd	440	503	1.82e-22	SMART
Pfam:NMDAR2_C	840	1482	2.1e-245	PFAM

Meta Mutation Damage Score

0.1235

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

98% (93/95)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] N-methyl-D-aspartate (NMDA) receptors are a class of ionotropic glutamate receptors. NMDA receptor channel has been shown to be involved in long-term potentiation, an activity-dependent increase in the efficiency of synaptic transmission thought to underlie certain kinds of memory and learning. NMDA receptor channels are heteromers composed of three different subunits: NR1 (GRIN1), NR2 (GRIN2A, GRIN2B, GRIN2C, or GRIN2D) and NR3 (GRIN3A or GRIN3B). The NR2 subunit acts as the agonist binding site for glutamate. This receptor is the predominant excitatory neurotransmitter receptor in the mammalian brain. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impairments in suckling, in hippocampal long term depression, and in pattern formation of trigeminal nucleus sensory afferent terminals. Mutants die shortly after birth. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930449I24Rik	T	A	5: 146,504,942	S300T	possibly damaging	Het
4932431P20Rik	T	C	7: 29,537,140		noncoding transcript	Het
A2ml1	A	C	6: 128,558,437	V770G	probably damaging	Het
Abca6	A	G	11: 110,219,649	I558T	probably benign	Het
Abhd17c	C	A	7: 84,110,662	G295W	probably damaging	Het
Actn3	G	A	19: 4,871,675	A159V	probably damaging	Het
Adgrv1	A	T	13: 81,557,080	F1537Y	probably damaging	Het
Agbl1	G	T	7: 76,419,880	V373F	possibly damaging	Het
Aldh1a1	A	T	19: 20,642,915	E485D	probably benign	Het
Amdhd2	A	G	17: 24,158,308		probably null	Het
Armc3	A	G	2: 19,201,811	D15G	probably damaging	Het
Atp2b2	A	G	6: 113,760,650	L921P	probably damaging	Het
Btbd16	A	G	7: 130,784,308	N88S	probably benign	Het
Capn10	T	A	1: 92,938,034	C77*	probably null	Het
Caskin1	T	C	17: 24,496,996		probably null	Het
Catsper4	T	C	4: 134,213,806	D254G	probably benign	Het
Catsperg1	T	C	7: 29,185,040	D958G	probably damaging	Het
Ccar2	T	G	14: 70,139,651	K787Q	probably benign	Het
Ccdc191	C	T	16: 43,908,635	T244I	probably benign	Het
Cd33	A	T	7: 43,530,275	L243Q	possibly damaging	Het
Cdc37	T	C	9: 21,149,847	Y4C	probably damaging	Het
Cenpe	T	G	3: 135,239,780	N1018K	probably benign	Het
Crocc	G	A	4: 141,017,096	R1830C	probably damaging	Het
Csmd1	T	C	8: 15,917,392	D3157G	probably damaging	Het
Dhx57	C	T	17: 80,273,048	V492M	probably damaging	Het
Dnah2	A	T	11: 69,458,185	I2486N	probably benign	Het
Dnhd1	C	T	7: 105,693,721	T1424I	possibly damaging	Het
Dsc3	C	T	18: 19,968,354	A661T	probably benign	Het
F930015N05Rik	A	G	11: 64,435,403		probably benign	Het
Fbxo34	C	A	14: 47,530,106	R308S	probably damaging	Het
Gm10608	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	9: 119,160,716		probably benign	Het
Gm11595	A	T	11: 99,772,501	C118S	unknown	Het
Gm9742	A	T	13: 8,034,975		noncoding transcript	Het
Gmeb2	G	A	2: 181,259,049	A185V	probably benign	Het
Gpr15	A	G	16: 58,718,255	V157A	possibly damaging	Het
Gpr3	C	T	4: 133,210,621	A247T	probably damaging	Het
Hmbs	T	C	9: 44,340,707	T92A	probably benign	Het
Inpp4a	A	G	1: 37,366,919	M173V	probably benign	Het
Irx4	T	A	13: 73,265,476	S22T	probably benign	Het
Jph3	C	T	8: 121,785,142	A623V	probably benign	Het
Kif1b	G	A	4: 149,187,640	S1568L	possibly damaging	Het
Ksr1	G	A	11: 79,033,313	S361L	probably damaging	Het
Lyst	T	G	13: 13,635,262	Y506D	probably damaging	Het
Mctp1	A	G	13: 76,824,822	D648G	probably damaging	Het
Megf8	T	C	7: 25,364,582	S2788P	possibly damaging	Het
Mfsd2b	T	A	12: 4,867,659	Y129F	probably benign	Het
Mindy4	T	C	6: 55,218,265	S155P	probably benign	Het
Mospd4	A	G	18: 46,465,664		noncoding transcript	Het
Myo18b	A	T	5: 112,831,078	L1223Q	probably damaging	Het
Nckipsd	A	G	9: 108,811,733	T156A	probably benign	Het
Ndst1	G	A	18: 60,691,208	T799I	probably benign	Het
Npffr2	A	T	5: 89,568,065	I84F	probably damaging	Het
Nphp3	G	A	9: 104,008,243	V167M	probably damaging	Het
Nup107	C	A	10: 117,774,475	R354L	possibly damaging	Het
Olfml2a	T	C	2: 38,941,687	C93R	probably damaging	Het
Olfr1145	A	G	2: 87,810,341	I174V	probably benign	Het
Olfr1157	A	T	2: 87,962,832	V20D	probably benign	Het
Olfr384	C	G	11: 73,602,805	S75C	possibly damaging	Het
Pappa	T	A	4: 65,297,257	L1134M	probably damaging	Het
Plscr4	T	G	9: 92,488,630	F217V	possibly damaging	Het
Pnpla8	T	A	12: 44,308,057	Y667N	probably benign	Het
Polg	A	G	7: 79,464,928	L95P	probably damaging	Het
Psg20	T	G	7: 18,682,718	I158L	probably damaging	Het
Pwwp2a	A	G	11: 43,705,318	S437G	probably benign	Het
Rdx	A	G	9: 52,069,732	M305V	possibly damaging	Het
Rinl	A	G	7: 28,796,743	E383G	probably damaging	Het
Ror1	A	G	4: 100,442,093	M888V	probably benign	Het
Rps12	A	T	10: 23,786,878	I22K	possibly damaging	Het
Rtca	C	A	3: 116,497,674	R219L	possibly damaging	Het
Ryr2	G	A	13: 11,712,195	P2427S	probably damaging	Het
Slc10a6	A	G	5: 103,609,056	Y281H	probably benign	Het
Slc39a11	A	G	11: 113,369,803	S176P	probably benign	Het
Slfn10-ps	A	G	11: 83,030,342		noncoding transcript	Het
Spef2	T	C	15: 9,729,661	T124A	possibly damaging	Het
Sult2a4	G	T	7: 13,915,260	P207Q	probably damaging	Het
Tas1r3	G	A	4: 155,860,470	R765C	probably damaging	Het
Tcstv1	T	C	13: 119,893,746	T117A	probably damaging	Het
Tha1	A	G	11: 117,869,774	V208A	probably damaging	Het
Tmbim4	T	A	10: 120,224,753	I215N	probably damaging	Het
Tmem202	T	A	9: 59,520,200	I122F	probably benign	Het
Tomm70a	T	C	16: 57,121,871	S4P	unknown	Het
Tpcn2	A	G	7: 145,273,975		probably benign	Het
Trim36	A	T	18: 46,212,337	F10I	probably benign	Het
Usp30	A	G	5: 114,111,163	E176G	probably damaging	Het
Usp8	T	G	2: 126,737,575		probably null	Het
Vmn1r32	T	A	6: 66,553,549	Y81F	probably benign	Het
Vps36	G	T	8: 22,218,289		probably null	Het
Wnt3	A	G	11: 103,812,648	H319R	possibly damaging	Het
Zfp319	A	T	8: 95,323,763		probably benign	Het
Zfp408	T	C	2: 91,645,174	E545G	probably damaging	Het
Zfp799	C	T	17: 32,819,498	R598Q	possibly damaging	Het
Zfp831	T	C	2: 174,648,124	V1228A	probably benign	Het
Zfp938	T	C	10: 82,226,042	D248G	probably benign	Het

Other mutations in Grin2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00494:Grin2b	APN	6	135736331	missense	possibly damaging	0.55
IGL00835:Grin2b	APN	6	135733570	missense	probably damaging	1.00
IGL01401:Grin2b	APN	6	135736363	missense	probably damaging	1.00
IGL01523:Grin2b	APN	6	136044265	missense	probably null	0.99
IGL01719:Grin2b	APN	6	135733381	missense	probably damaging	0.97
IGL01907:Grin2b	APN	6	135733740	missense	probably damaging	1.00
IGL01996:Grin2b	APN	6	135732586	missense	probably damaging	1.00
IGL02309:Grin2b	APN	6	135736472	missense	probably damaging	1.00
IGL02312:Grin2b	APN	6	135739090	missense	probably damaging	1.00
IGL02409:Grin2b	APN	6	136043908	missense	possibly damaging	0.89
IGL02527:Grin2b	APN	6	135923391	missense	probably damaging	1.00
IGL02535:Grin2b	APN	6	135779369	missense	possibly damaging	0.70
IGL02570:Grin2b	APN	6	135922998	missense	probably damaging	1.00
IGL02702:Grin2b	APN	6	135739132	missense	probably damaging	0.99
IGL03001:Grin2b	APN	6	135739115	missense	probably damaging	1.00
IGL03274:Grin2b	APN	6	135780255	missense	possibly damaging	0.90
R0055:Grin2b	UTSW	6	135923203	missense	probably benign
R0055:Grin2b	UTSW	6	135923203	missense	probably benign
R0164:Grin2b	UTSW	6	135778648	splice site	probably benign
R0194:Grin2b	UTSW	6	135779305	missense	probably damaging	1.00
R0594:Grin2b	UTSW	6	135733929	missense	probably damaging	1.00
R1434:Grin2b	UTSW	6	135843195	missense	probably benign	0.04
R1928:Grin2b	UTSW	6	136044046	missense	probably damaging	1.00
R1942:Grin2b	UTSW	6	135732732	missense	possibly damaging	0.93
R1996:Grin2b	UTSW	6	136044211	missense	possibly damaging	0.52
R2002:Grin2b	UTSW	6	135733245	missense	probably damaging	1.00
R2020:Grin2b	UTSW	6	135733896	missense	probably benign	0.12
R2103:Grin2b	UTSW	6	135780140	missense	probably benign	0.02
R2495:Grin2b	UTSW	6	135733182	missense	probably damaging	1.00
R2656:Grin2b	UTSW	6	135733429	missense	probably damaging	1.00
R2847:Grin2b	UTSW	6	135740953	missense	probably damaging	1.00
R2866:Grin2b	UTSW	6	135733639	missense	probably damaging	1.00
R2867:Grin2b	UTSW	6	135733639	missense	probably damaging	1.00
R2867:Grin2b	UTSW	6	135733639	missense	probably damaging	1.00
R3196:Grin2b	UTSW	6	135732455	small deletion	probably benign
R3418:Grin2b	UTSW	6	135843110	missense	probably benign	0.02
R3808:Grin2b	UTSW	6	135923271	missense	probably damaging	0.99
R4028:Grin2b	UTSW	6	135736435	missense	probably damaging	1.00
R4602:Grin2b	UTSW	6	135778741	missense	probably damaging	1.00
R4624:Grin2b	UTSW	6	135733825	missense	probably damaging	0.99
R4677:Grin2b	UTSW	6	135774872	missense	probably benign	0.13
R4744:Grin2b	UTSW	6	135778699	missense	probably damaging	1.00
R5020:Grin2b	UTSW	6	135733407	missense	probably benign	0.01
R5051:Grin2b	UTSW	6	135779395	missense	possibly damaging	0.84
R5105:Grin2b	UTSW	6	135732441	missense	probably benign	0.03
R5125:Grin2b	UTSW	6	135923299	missense	possibly damaging	0.89
R5146:Grin2b	UTSW	6	135779342	missense	probably damaging	1.00
R5318:Grin2b	UTSW	6	135733918	missense	probably damaging	0.99
R5349:Grin2b	UTSW	6	136044283	missense	possibly damaging	0.93
R5426:Grin2b	UTSW	6	135732368	missense	probably damaging	1.00
R5438:Grin2b	UTSW	6	135736306	missense	probably damaging	1.00
R5439:Grin2b	UTSW	6	135736306	missense	probably damaging	1.00
R5440:Grin2b	UTSW	6	135736306	missense	probably damaging	1.00
R5530:Grin2b	UTSW	6	135733723	missense	probably benign	0.00
R5603:Grin2b	UTSW	6	135923397	missense	probably damaging	1.00
R5657:Grin2b	UTSW	6	135733087	missense	possibly damaging	0.48
R5788:Grin2b	UTSW	6	135740964	missense	probably benign	0.24
R5941:Grin2b	UTSW	6	135736373	missense	probably damaging	0.99
R6057:Grin2b	UTSW	6	135733944	missense	possibly damaging	0.84
R6137:Grin2b	UTSW	6	135923458	missense	possibly damaging	0.89
R6216:Grin2b	UTSW	6	135772399	missense	probably damaging	1.00
R6309:Grin2b	UTSW	6	135733027	missense	probably benign	0.00
R6316:Grin2b	UTSW	6	135780279	missense	probably benign	0.00
R6419:Grin2b	UTSW	6	135740967	missense	probably damaging	1.00
R6551:Grin2b	UTSW	6	135733344	missense	probably damaging	1.00
R6612:Grin2b	UTSW	6	135740998	missense	probably damaging	1.00
R6616:Grin2b	UTSW	6	135732551	missense	probably benign
R6647:Grin2b	UTSW	6	135733110	missense	probably damaging	1.00
R6806:Grin2b	UTSW	6	135774828	missense	possibly damaging	0.84
R6976:Grin2b	UTSW	6	135780200	missense	probably benign
R7033:Grin2b	UTSW	6	135923038	missense	probably damaging	1.00
R7058:Grin2b	UTSW	6	135780306	missense	probably damaging	0.97
R7144:Grin2b	UTSW	6	135733476	missense	possibly damaging	0.50
R7190:Grin2b	UTSW	6	135732948	missense	possibly damaging	0.46
R7238:Grin2b	UTSW	6	135780251	missense	probably damaging	0.97
R7453:Grin2b	UTSW	6	135740949	missense	possibly damaging	0.56
R7553:Grin2b	UTSW	6	135772396	missense	possibly damaging	0.88
R7585:Grin2b	UTSW	6	135779303	missense	probably damaging	0.99
R7615:Grin2b	UTSW	6	135923364	missense	probably damaging	1.00
R7632:Grin2b	UTSW	6	135732555	missense	probably benign	0.02
R7779:Grin2b	UTSW	6	135778794	nonsense	probably null
R8058:Grin2b	UTSW	6	135733227	missense	probably damaging	1.00
R8084:Grin2b	UTSW	6	135733488	missense	probably benign	0.03
R8145:Grin2b	UTSW	6	135732499	missense	probably benign	0.01
R8308:Grin2b	UTSW	6	135923076	missense	probably damaging	0.99
R8357:Grin2b	UTSW	6	135732199	missense	probably benign	0.00
R8379:Grin2b	UTSW	6	135922969	missense	probably damaging	1.00
R8429:Grin2b	UTSW	6	135733916	missense	probably damaging	1.00
R8457:Grin2b	UTSW	6	135732199	missense	probably benign	0.00
R8746:Grin2b	UTSW	6	135922987	missense	probably benign	0.02
R8925:Grin2b	UTSW	6	135772341	missense	probably damaging	0.97
R8927:Grin2b	UTSW	6	135772341	missense	probably damaging	0.97
R8963:Grin2b	UTSW	6	136044009	missense	probably damaging	1.00
R9075:Grin2b	UTSW	6	135732511	frame shift	probably null
R9076:Grin2b	UTSW	6	135732511	frame shift	probably null
R9172:Grin2b	UTSW	6	135779257	missense	possibly damaging	0.84
R9520:Grin2b	UTSW	6	135733401	missense	probably damaging	1.00
R9740:Grin2b	UTSW	6	135922870	critical splice donor site	probably null
RF001:Grin2b	UTSW	6	136044240	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ACATCATACCTCAATGATTCCTGGG -3'
(R):5'- TGGGCCATGAGAATTTTGCC -3'

Sequencing Primer
(F):5'- TCAATGATTCCTGGGTGCTC -3'
(R):5'- CCATGAGAATTTTGCCTGTGATGGAC -3'

Posted On

2014-09-17