Mutagenetix > Incidental Mutation

Incidental Mutation 'R2127:Catsperg1'

227617

Institutional Source

Beutler Lab

Gene Symbol

Catsperg1

Ensembl Gene

ENSMUSG00000049676

Gene Name

cation channel sperm associated auxiliary subunit gamma 1

Synonyms

A230107C01Rik, Catsperg

MMRRC Submission

040130-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.061) question?

Stock #

R2127 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

29181321-29214035 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 29185040 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 958 (D958G)

Ref Sequence

ENSEMBL: ENSMUSP00000129837 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047846] [ENSMUST00000059642] [ENSMUST00000163782] [ENSMUST00000164653] [ENSMUST00000169143] [ENSMUST00000182328] [ENSMUST00000209034] [ENSMUST00000186182]

AlphaFold

E9Q355

Predicted Effect

probably damaging
Transcript: ENSMUST00000047846
AA Change: D905G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000045233
Gene: ENSMUSG00000049676
AA Change: D905G

Domain	Start	End	E-Value	Type
Pfam:CATSPERG	1	920	N/A	PFAM
transmembrane domain	1012	1034	N/A	INTRINSIC
low complexity region	1058	1073	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000059642

SMART Domains

Protein: ENSMUSP00000051657
Gene: ENSMUSG00000030591

Domain	Start	End	E-Value	Type
low complexity region	11	23	N/A	INTRINSIC
low complexity region	60	82	N/A	INTRINSIC
low complexity region	117	129	N/A	INTRINSIC
Pfam:CSN8_PSD8_EIF3K	189	330	1.2e-40	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000085819

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000163445

Predicted Effect

probably benign
Transcript: ENSMUST00000163782

SMART Domains

Protein: ENSMUSP00000127409
Gene: ENSMUSG00000049676

Domain	Start	End	E-Value	Type
Pfam:CATSPERG	1	93	1.7e-52	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000164653

SMART Domains

Protein: ENSMUSP00000131827
Gene: ENSMUSG00000049676

Domain	Start	End	E-Value	Type
Pfam:CATSPERG	1	111	1.4e-44	PFAM
Pfam:CATSPERG	108	334	8.5e-93	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000166419

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000166654

Predicted Effect

probably damaging
Transcript: ENSMUST00000169143
AA Change: D958G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000129837
Gene: ENSMUSG00000049676
AA Change: D958G

Domain	Start	End	E-Value	Type
Pfam:CATSPERG	2	973	N/A	PFAM
transmembrane domain	1065	1087	N/A	INTRINSIC
low complexity region	1111	1126	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000170118

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000171102

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000172226

Predicted Effect

probably benign
Transcript: ENSMUST00000182328

SMART Domains

Protein: ENSMUSP00000138613
Gene: ENSMUSG00000030591

Domain	Start	End	E-Value	Type
low complexity region	2	18	N/A	INTRINSIC
Pfam:SAC3_GANP	49	232	1.2e-37	PFAM
Pfam:PCI_Csn8	125	266	4.1e-42	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000209034

Predicted Effect

probably benign
Transcript: ENSMUST00000186182

SMART Domains

Protein: ENSMUSP00000139514
Gene: ENSMUSG00000030591

Domain	Start	End	E-Value	Type
low complexity region	11	23	N/A	INTRINSIC
low complexity region	60	82	N/A	INTRINSIC
Pfam:SAC3_GANP	113	296	1.3e-37	PFAM
Pfam:PCI_Csn8	189	330	2.3e-42	PFAM

Meta Mutation Damage Score

0.1203

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

98% (93/95)

Allele List at MGI

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930449I24Rik	T	A	5: 146,504,942	S300T	possibly damaging	Het
4932431P20Rik	T	C	7: 29,537,140		noncoding transcript	Het
A2ml1	A	C	6: 128,558,437	V770G	probably damaging	Het
Abca6	A	G	11: 110,219,649	I558T	probably benign	Het
Abhd17c	C	A	7: 84,110,662	G295W	probably damaging	Het
Actn3	G	A	19: 4,871,675	A159V	probably damaging	Het
Adgrv1	A	T	13: 81,557,080	F1537Y	probably damaging	Het
Agbl1	G	T	7: 76,419,880	V373F	possibly damaging	Het
Aldh1a1	A	T	19: 20,642,915	E485D	probably benign	Het
Amdhd2	A	G	17: 24,158,308		probably null	Het
Armc3	A	G	2: 19,201,811	D15G	probably damaging	Het
Atp2b2	A	G	6: 113,760,650	L921P	probably damaging	Het
Btbd16	A	G	7: 130,784,308	N88S	probably benign	Het
Capn10	T	A	1: 92,938,034	C77*	probably null	Het
Caskin1	T	C	17: 24,496,996		probably null	Het
Catsper4	T	C	4: 134,213,806	D254G	probably benign	Het
Ccar2	T	G	14: 70,139,651	K787Q	probably benign	Het
Ccdc191	C	T	16: 43,908,635	T244I	probably benign	Het
Cd33	A	T	7: 43,530,275	L243Q	possibly damaging	Het
Cdc37	T	C	9: 21,149,847	Y4C	probably damaging	Het
Cenpe	T	G	3: 135,239,780	N1018K	probably benign	Het
Crocc	G	A	4: 141,017,096	R1830C	probably damaging	Het
Csmd1	T	C	8: 15,917,392	D3157G	probably damaging	Het
Dhx57	C	T	17: 80,273,048	V492M	probably damaging	Het
Dnah2	A	T	11: 69,458,185	I2486N	probably benign	Het
Dnhd1	C	T	7: 105,693,721	T1424I	possibly damaging	Het
Dsc3	C	T	18: 19,968,354	A661T	probably benign	Het
F930015N05Rik	A	G	11: 64,435,403		probably benign	Het
Fbxo34	C	A	14: 47,530,106	R308S	probably damaging	Het
Gm10608	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	9: 119,160,716		probably benign	Het
Gm11595	A	T	11: 99,772,501	C118S	unknown	Het
Gm9742	A	T	13: 8,034,975		noncoding transcript	Het
Gmeb2	G	A	2: 181,259,049	A185V	probably benign	Het
Gpr15	A	G	16: 58,718,255	V157A	possibly damaging	Het
Gpr3	C	T	4: 133,210,621	A247T	probably damaging	Het
Grin2b	A	C	6: 135,778,700	S539A	probably benign	Het
Hmbs	T	C	9: 44,340,707	T92A	probably benign	Het
Inpp4a	A	G	1: 37,366,919	M173V	probably benign	Het
Irx4	T	A	13: 73,265,476	S22T	probably benign	Het
Jph3	C	T	8: 121,785,142	A623V	probably benign	Het
Kif1b	G	A	4: 149,187,640	S1568L	possibly damaging	Het
Ksr1	G	A	11: 79,033,313	S361L	probably damaging	Het
Lyst	T	G	13: 13,635,262	Y506D	probably damaging	Het
Mctp1	A	G	13: 76,824,822	D648G	probably damaging	Het
Megf8	T	C	7: 25,364,582	S2788P	possibly damaging	Het
Mfsd2b	T	A	12: 4,867,659	Y129F	probably benign	Het
Mindy4	T	C	6: 55,218,265	S155P	probably benign	Het
Mospd4	A	G	18: 46,465,664		noncoding transcript	Het
Myo18b	A	T	5: 112,831,078	L1223Q	probably damaging	Het
Nckipsd	A	G	9: 108,811,733	T156A	probably benign	Het
Ndst1	G	A	18: 60,691,208	T799I	probably benign	Het
Npffr2	A	T	5: 89,568,065	I84F	probably damaging	Het
Nphp3	G	A	9: 104,008,243	V167M	probably damaging	Het
Nup107	C	A	10: 117,774,475	R354L	possibly damaging	Het
Olfml2a	T	C	2: 38,941,687	C93R	probably damaging	Het
Olfr1145	A	G	2: 87,810,341	I174V	probably benign	Het
Olfr1157	A	T	2: 87,962,832	V20D	probably benign	Het
Olfr384	C	G	11: 73,602,805	S75C	possibly damaging	Het
Pappa	T	A	4: 65,297,257	L1134M	probably damaging	Het
Plscr4	T	G	9: 92,488,630	F217V	possibly damaging	Het
Pnpla8	T	A	12: 44,308,057	Y667N	probably benign	Het
Polg	A	G	7: 79,464,928	L95P	probably damaging	Het
Psg20	T	G	7: 18,682,718	I158L	probably damaging	Het
Pwwp2a	A	G	11: 43,705,318	S437G	probably benign	Het
Rdx	A	G	9: 52,069,732	M305V	possibly damaging	Het
Rinl	A	G	7: 28,796,743	E383G	probably damaging	Het
Ror1	A	G	4: 100,442,093	M888V	probably benign	Het
Rps12	A	T	10: 23,786,878	I22K	possibly damaging	Het
Rtca	C	A	3: 116,497,674	R219L	possibly damaging	Het
Ryr2	G	A	13: 11,712,195	P2427S	probably damaging	Het
Slc10a6	A	G	5: 103,609,056	Y281H	probably benign	Het
Slc39a11	A	G	11: 113,369,803	S176P	probably benign	Het
Slfn10-ps	A	G	11: 83,030,342		noncoding transcript	Het
Spef2	T	C	15: 9,729,661	T124A	possibly damaging	Het
Sult2a4	G	T	7: 13,915,260	P207Q	probably damaging	Het
Tas1r3	G	A	4: 155,860,470	R765C	probably damaging	Het
Tcstv1	T	C	13: 119,893,746	T117A	probably damaging	Het
Tha1	A	G	11: 117,869,774	V208A	probably damaging	Het
Tmbim4	T	A	10: 120,224,753	I215N	probably damaging	Het
Tmem202	T	A	9: 59,520,200	I122F	probably benign	Het
Tomm70a	T	C	16: 57,121,871	S4P	unknown	Het
Tpcn2	A	G	7: 145,273,975		probably benign	Het
Trim36	A	T	18: 46,212,337	F10I	probably benign	Het
Usp30	A	G	5: 114,111,163	E176G	probably damaging	Het
Usp8	T	G	2: 126,737,575		probably null	Het
Vmn1r32	T	A	6: 66,553,549	Y81F	probably benign	Het
Vps36	G	T	8: 22,218,289		probably null	Het
Wnt3	A	G	11: 103,812,648	H319R	possibly damaging	Het
Zfp319	A	T	8: 95,323,763		probably benign	Het
Zfp408	T	C	2: 91,645,174	E545G	probably damaging	Het
Zfp799	C	T	17: 32,819,498	R598Q	possibly damaging	Het
Zfp831	T	C	2: 174,648,124	V1228A	probably benign	Het
Zfp938	T	C	10: 82,226,042	D248G	probably benign	Het

Other mutations in Catsperg1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00808:Catsperg1	APN	7	29198146	missense	probably damaging	1.00
IGL01693:Catsperg1	APN	7	29185098	unclassified	probably benign
IGL01935:Catsperg1	APN	7	29195871	splice site	probably null
IGL02484:Catsperg1	APN	7	29210920	start gained	probably benign
IGL02584:Catsperg1	APN	7	29184721	missense	probably damaging	1.00
IGL02880:Catsperg1	APN	7	29195485	missense	possibly damaging	0.75
IGL03268:Catsperg1	APN	7	29200243	missense	probably damaging	1.00
IGL03285:Catsperg1	APN	7	29198172	missense	possibly damaging	0.89
solid	UTSW	7	29190298	nonsense	probably null
K7894:Catsperg1	UTSW	7	29197154	intron	probably benign
R0180:Catsperg1	UTSW	7	29190431	splice site	probably null
R0344:Catsperg1	UTSW	7	29195540	missense	probably damaging	1.00
R0523:Catsperg1	UTSW	7	29185190	unclassified	probably benign
R0561:Catsperg1	UTSW	7	29182312	missense	probably damaging	1.00
R0610:Catsperg1	UTSW	7	29190619	missense	probably damaging	1.00
R0762:Catsperg1	UTSW	7	29189952	missense	probably benign	0.03
R1074:Catsperg1	UTSW	7	29206849	missense	probably damaging	1.00
R1201:Catsperg1	UTSW	7	29191670	missense	possibly damaging	0.77
R1346:Catsperg1	UTSW	7	29182334	splice site	probably null
R1387:Catsperg1	UTSW	7	29206864	missense	probably damaging	1.00
R1467:Catsperg1	UTSW	7	29185008	missense	probably damaging	1.00
R1467:Catsperg1	UTSW	7	29185008	missense	probably damaging	1.00
R1486:Catsperg1	UTSW	7	29185495	missense	probably damaging	1.00
R1883:Catsperg1	UTSW	7	29182236	critical splice donor site	probably null
R1932:Catsperg1	UTSW	7	29198143	missense	probably damaging	1.00
R1942:Catsperg1	UTSW	7	29206807	missense	possibly damaging	0.89
R2205:Catsperg1	UTSW	7	29185246	nonsense	probably null
R4214:Catsperg1	UTSW	7	29195932	missense	possibly damaging	0.80
R4678:Catsperg1	UTSW	7	29190296	missense	probably benign	0.13
R5008:Catsperg1	UTSW	7	29195434	nonsense	probably null
R5217:Catsperg1	UTSW	7	29190298	nonsense	probably null
R5268:Catsperg1	UTSW	7	29195247	missense	probably benign	0.41
R5372:Catsperg1	UTSW	7	29210712	missense	probably benign	0.08
R5393:Catsperg1	UTSW	7	29185499	missense	probably damaging	1.00
R5406:Catsperg1	UTSW	7	29185523	missense	probably damaging	1.00
R5557:Catsperg1	UTSW	7	29195871	missense	possibly damaging	0.89
R5921:Catsperg1	UTSW	7	29190523	missense	possibly damaging	0.78
R5928:Catsperg1	UTSW	7	29206615	missense	probably damaging	0.99
R5960:Catsperg1	UTSW	7	29184783	unclassified	probably benign
R6053:Catsperg1	UTSW	7	29210814	nonsense	probably null
R6144:Catsperg1	UTSW	7	29210695	missense	probably damaging	0.99
R6215:Catsperg1	UTSW	7	29200239	missense	probably damaging	1.00
R6334:Catsperg1	UTSW	7	29206357	missense	probably benign	0.01
R6446:Catsperg1	UTSW	7	29206567	missense	probably benign	0.00
R6854:Catsperg1	UTSW	7	29181702	missense	possibly damaging	0.72
R7171:Catsperg1	UTSW	7	29185212	missense	probably damaging	1.00
R7326:Catsperg1	UTSW	7	29210759	missense	possibly damaging	0.82
R7382:Catsperg1	UTSW	7	29204844	missense	probably benign	0.02
R7473:Catsperg1	UTSW	7	29195478	missense	probably damaging	1.00
R7555:Catsperg1	UTSW	7	29189814	missense	probably damaging	0.97
R7714:Catsperg1	UTSW	7	29185482	missense	probably null	1.00
R7914:Catsperg1	UTSW	7	29195426	missense	probably benign
R7935:Catsperg1	UTSW	7	29195919	missense	possibly damaging	0.94
R8684:Catsperg1	UTSW	7	29198400	missense	probably damaging	1.00
R8733:Catsperg1	UTSW	7	29191686	missense	possibly damaging	0.95
R8821:Catsperg1	UTSW	7	29204936	splice site	probably benign
R9014:Catsperg1	UTSW	7	29206641	missense	probably damaging	1.00
R9016:Catsperg1	UTSW	7	29191737	missense	probably benign
R9093:Catsperg1	UTSW	7	29184727	missense	probably damaging	1.00
R9094:Catsperg1	UTSW	7	29184727	missense	probably damaging	1.00
R9096:Catsperg1	UTSW	7	29184727	missense	probably damaging	1.00
R9146:Catsperg1	UTSW	7	29210487	missense	probably benign	0.07
R9149:Catsperg1	UTSW	7	29210487	missense	probably benign	0.07
R9297:Catsperg1	UTSW	7	29191660	missense	probably benign	0.23
R9339:Catsperg1	UTSW	7	29195460	missense	probably benign	0.44
R9435:Catsperg1	UTSW	7	29190326	missense	probably benign	0.02
R9451:Catsperg1	UTSW	7	29198347	critical splice donor site	probably null
R9478:Catsperg1	UTSW	7	29198352	missense	possibly damaging	0.55
R9557:Catsperg1	UTSW	7	29204798	missense	not run
Z1186:Catsperg1	UTSW	7	29181861	missense	possibly damaging	0.85
Z1186:Catsperg1	UTSW	7	29181862	missense	possibly damaging	0.85
Z1186:Catsperg1	UTSW	7	29181872	missense	probably benign	0.00
Z1186:Catsperg1	UTSW	7	29182052	missense	probably damaging	1.00
Z1186:Catsperg1	UTSW	7	29182122	missense	probably benign	0.00
Z1186:Catsperg1	UTSW	7	29190250	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AATAGTTCTCAGCACCTAAGGG -3'
(R):5'- ACTCTGGCAGTTTCTTGGGC -3'

Sequencing Primer
(F):5'- GGATTGTGGAACCCTAGACATTACTG -3'
(R):5'- CAGGTGAGGAGAGACTGGTTGC -3'

Posted On

2014-09-17