Mutagenetix > Incidental Mutations

Incidental Mutation 'R2127:Agbl1'

227620

Institutional Source

Beutler Lab

Gene Symbol

Agbl1

Ensembl Gene

ENSMUSG00000025754

Gene Name

ATP/GTP binding protein-like 1

Synonyms

Nna1-l1, EG244071

MMRRC Submission

040130-MU

Accession Numbers

Ncbi RefSeq: NM_001199224.1; MGI:3646469

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2127 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

76229887-77124698 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 76419880 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Phenylalanine at position 373 (V373F)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026854] [ENSMUST00000107442] [ENSMUST00000156166]

Predicted Effect

probably benign
Transcript: ENSMUST00000026854
AA Change: V135F

PolyPhen 2 Score 0.155 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000026854
Gene: ENSMUSG00000025754
AA Change: V135F

Domain	Start	End	E-Value	Type
low complexity region	48	64	N/A	INTRINSIC
Pfam:Peptidase_M14	493	631	4.4e-22	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000107442
AA Change: V135F

PolyPhen 2 Score 0.456 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000103066
Gene: ENSMUSG00000025754
AA Change: V135F

Domain	Start	End	E-Value	Type
low complexity region	48	64	N/A	INTRINSIC
Pfam:Peptidase_M14	494	754	3.1e-27	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000156166
AA Change: V387F

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000119721
Gene: ENSMUSG00000025754
AA Change: V387F

Domain	Start	End	E-Value	Type
low complexity region	254	270	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000166190
AA Change: V373F

PolyPhen 2 Score 0.642 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000128342
Gene: ENSMUSG00000025754
AA Change: V373F

Domain	Start	End	E-Value	Type
low complexity region	286	302	N/A	INTRINSIC
Pfam:Peptidase_M14	737	871	7.4e-14	PFAM

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

98% (93/95)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Polyglutamylation is a reversible posttranslational modification catalyzed by polyglutamylases that results in the addition of glutamate side chains on the modified protein. This gene encodes a glutamate decarboxylase that catalyzes the deglutamylation of polyglutamylated proteins. Mutations in this gene result in dominant late-onset Fuchs corneal dystrophy. [provided by RefSeq, Nov 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal response to herpes simplex virus (HSV) and vaccinia virus (VACV) infection. [provided by MGI curators]

Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930449I24Rik	T	A	5: 146,504,942	S300T	possibly damaging	Het
4932431P20Rik	T	C	7: 29,537,140		noncoding transcript	Het
A2ml1	A	C	6: 128,558,437	V770G	probably damaging	Het
Abca6	A	G	11: 110,219,649	I558T	probably benign	Het
Abhd17c	C	A	7: 84,110,662	G295W	probably damaging	Het
Actn3	G	A	19: 4,871,675	A159V	probably damaging	Het
Adgrv1	A	T	13: 81,557,080	F1537Y	probably damaging	Het
Aldh1a1	A	T	19: 20,642,915	E485D	probably benign	Het
Amdhd2	A	G	17: 24,158,308		probably null	Het
Armc3	A	G	2: 19,201,811	D15G	probably damaging	Het
Atp2b2	A	G	6: 113,760,650	L921P	probably damaging	Het
Btbd16	A	G	7: 130,784,308	N88S	probably benign	Het
Capn10	T	A	1: 92,938,034	C77*	probably null	Het
Caskin1	T	C	17: 24,496,996		probably null	Het
Catsper4	T	C	4: 134,213,806	D254G	probably benign	Het
Catsperg1	T	C	7: 29,185,040	D958G	probably damaging	Het
Ccar2	T	G	14: 70,139,651	K787Q	probably benign	Het
Ccdc191	C	T	16: 43,908,635	T244I	probably benign	Het
Cd33	A	T	7: 43,530,275	L243Q	possibly damaging	Het
Cdc37	T	C	9: 21,149,847	Y4C	probably damaging	Het
Cenpe	T	G	3: 135,239,780	N1018K	probably benign	Het
Crocc	G	A	4: 141,017,096	R1830C	probably damaging	Het
Csmd1	T	C	8: 15,917,392	D3157G	probably damaging	Het
Dhx57	C	T	17: 80,273,048	V492M	probably damaging	Het
Dnah2	A	T	11: 69,458,185	I2486N	probably benign	Het
Dnhd1	C	T	7: 105,693,721	T1424I	possibly damaging	Het
Dsc3	C	T	18: 19,968,354	A661T	probably benign	Het
F930015N05Rik	A	G	11: 64,435,403		probably benign	Het
Fbxo34	C	A	14: 47,530,106	R308S	probably damaging	Het
Gm10608	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	9: 119,160,716		probably benign	Het
Gm11595	A	T	11: 99,772,501	C118S	unknown	Het
Gm9742	A	T	13: 8,034,975		noncoding transcript	Het
Gmeb2	G	A	2: 181,259,049	A185V	probably benign	Het
Gpr15	A	G	16: 58,718,255	V157A	possibly damaging	Het
Gpr3	C	T	4: 133,210,621	A247T	probably damaging	Het
Grin2b	A	C	6: 135,778,700	S539A	probably benign	Het
Hmbs	T	C	9: 44,340,707	T92A	probably benign	Het
Inpp4a	A	G	1: 37,366,919	M173V	probably benign	Het
Irx4	T	A	13: 73,265,476	S22T	probably benign	Het
Jph3	C	T	8: 121,785,142	A623V	probably benign	Het
Kif1b	G	A	4: 149,187,640	S1568L	possibly damaging	Het
Ksr1	G	A	11: 79,033,313	S361L	probably damaging	Het
Lyst	T	G	13: 13,635,262	Y506D	probably damaging	Het
Mctp1	A	G	13: 76,824,822	D648G	probably damaging	Het
Megf8	T	C	7: 25,364,582	S2788P	possibly damaging	Het
Mfsd2b	T	A	12: 4,867,659	Y129F	probably benign	Het
Mindy4	T	C	6: 55,218,265	S155P	probably benign	Het
Mospd4	A	G	18: 46,465,664		noncoding transcript	Het
Myo18b	A	T	5: 112,831,078	L1223Q	probably damaging	Het
Nckipsd	A	G	9: 108,811,733	T156A	probably benign	Het
Ndst1	G	A	18: 60,691,208	T799I	probably benign	Het
Npffr2	A	T	5: 89,568,065	I84F	probably damaging	Het
Nphp3	G	A	9: 104,008,243	V167M	probably damaging	Het
Nup107	C	A	10: 117,774,475	R354L	possibly damaging	Het
Olfml2a	T	C	2: 38,941,687	C93R	probably damaging	Het
Olfr1145	A	G	2: 87,810,341	I174V	probably benign	Het
Olfr1157	A	T	2: 87,962,832	V20D	probably benign	Het
Olfr384	C	G	11: 73,602,805	S75C	possibly damaging	Het
Pappa	T	A	4: 65,297,257	L1134M	probably damaging	Het
Plscr4	T	G	9: 92,488,630	F217V	possibly damaging	Het
Pnpla8	T	A	12: 44,308,057	Y667N	probably benign	Het
Polg	A	G	7: 79,464,928	L95P	probably damaging	Het
Psg20	T	G	7: 18,682,718	I158L	probably damaging	Het
Pwwp2a	A	G	11: 43,705,318	S437G	probably benign	Het
Rdx	A	G	9: 52,069,732	M305V	possibly damaging	Het
Rinl	A	G	7: 28,796,743	E383G	probably damaging	Het
Ror1	A	G	4: 100,442,093	M888V	probably benign	Het
Rps12	A	T	10: 23,786,878	I22K	possibly damaging	Het
Rtca	C	A	3: 116,497,674	R219L	possibly damaging	Het
Ryr2	G	A	13: 11,712,195	P2427S	probably damaging	Het
Slc10a6	A	G	5: 103,609,056	Y281H	probably benign	Het
Slc39a11	A	G	11: 113,369,803	S176P	probably benign	Het
Slfn10-ps	A	G	11: 83,030,342		noncoding transcript	Het
Spef2	T	C	15: 9,729,661	T124A	possibly damaging	Het
Sult2a4	G	T	7: 13,915,260	P207Q	probably damaging	Het
Tas1r3	G	A	4: 155,860,470	R765C	probably damaging	Het
Tcstv1	T	C	13: 119,893,746	T117A	probably damaging	Het
Tha1	A	G	11: 117,869,774	V208A	probably damaging	Het
Tmbim4	T	A	10: 120,224,753	I215N	probably damaging	Het
Tmem202	T	A	9: 59,520,200	I122F	probably benign	Het
Tomm70a	T	C	16: 57,121,871	S4P	unknown	Het
Tpcn2	A	G	7: 145,273,975		probably benign	Het
Trim36	A	T	18: 46,212,337	F10I	probably benign	Het
Usp30	A	G	5: 114,111,163	E176G	probably damaging	Het
Usp8	T	G	2: 126,737,575		probably null	Het
Vmn1r32	T	A	6: 66,553,549	Y81F	probably benign	Het
Vps36	G	T	8: 22,218,289		probably null	Het
Wnt3	A	G	11: 103,812,648	H319R	possibly damaging	Het
Zfp319	A	T	8: 95,323,763		probably benign	Het
Zfp408	T	C	2: 91,645,174	E545G	probably damaging	Het
Zfp799	C	T	17: 32,819,498	R598Q	possibly damaging	Het
Zfp831	T	C	2: 174,648,124	V1228A	probably benign	Het
Zfp938	T	C	10: 82,226,042	D248G	probably benign	Het

Other mutations in Agbl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01567:Agbl1	APN	7	76421880	missense	probably benign	0.01
IGL01650:Agbl1	APN	7	76420319	missense	probably damaging	1.00
IGL02244:Agbl1	APN	7	76766372	missense	probably damaging	1.00
IGL03088:Agbl1	APN	7	76720142	missense	probably benign	0.12
IGL03143:Agbl1	APN	7	76420045	nonsense	probably null
IGL03306:Agbl1	APN	7	76589504	missense	probably damaging	1.00
R0001:Agbl1	UTSW	7	76419863	missense	probably damaging	0.98
R0045:Agbl1	UTSW	7	76698840	critical splice donor site	probably null
R0045:Agbl1	UTSW	7	76698840	critical splice donor site	probably null
R0541:Agbl1	UTSW	7	76409245	missense	probably benign	0.22
R1889:Agbl1	UTSW	7	76589381	missense	probably damaging	1.00
R2089:Agbl1	UTSW	7	76589500	missense	probably damaging	0.98
R2091:Agbl1	UTSW	7	76589500	missense	probably damaging	0.98
R2091:Agbl1	UTSW	7	76589500	missense	probably damaging	0.98
R2148:Agbl1	UTSW	7	76414717	splice site	probably null
R2229:Agbl1	UTSW	7	76433378	missense	probably benign	0.43
R2243:Agbl1	UTSW	7	76418722	missense	possibly damaging	0.93
R2255:Agbl1	UTSW	7	76422184	missense	probably damaging	1.00
R2411:Agbl1	UTSW	7	76720150	missense	probably damaging	1.00
R2426:Agbl1	UTSW	7	76421902	missense	probably damaging	1.00
R2508:Agbl1	UTSW	7	76589550	critical splice donor site	probably null
R2910:Agbl1	UTSW	7	76419838	missense	probably benign	0.13
R2919:Agbl1	UTSW	7	76414658	missense	probably damaging	1.00
R3056:Agbl1	UTSW	7	76766484	missense	possibly damaging	0.60
R3153:Agbl1	UTSW	7	76720196	missense	probably damaging	1.00
R3770:Agbl1	UTSW	7	76425929	critical splice donor site	probably null
R3825:Agbl1	UTSW	7	76419967	missense	probably damaging	0.99
R4632:Agbl1	UTSW	7	76413685	missense	probably benign	0.00
R4857:Agbl1	UTSW	7	76419835	missense	probably benign	0.03
R4943:Agbl1	UTSW	7	76420016	missense	probably benign	0.01
R5055:Agbl1	UTSW	7	76413577	missense	probably damaging	1.00
R5071:Agbl1	UTSW	7	76421917	missense	probably damaging	1.00
R5072:Agbl1	UTSW	7	76421917	missense	probably damaging	1.00
R5074:Agbl1	UTSW	7	76421917	missense	probably damaging	1.00
R5095:Agbl1	UTSW	7	76720133	missense	probably damaging	0.96
R5133:Agbl1	UTSW	7	76422156	missense	probably benign	0.21
R5576:Agbl1	UTSW	7	76335237	missense	probably benign	0.03
R5665:Agbl1	UTSW	7	76589503	missense	probably damaging	1.00
R5849:Agbl1	UTSW	7	76325098	missense	probably benign	0.35
R5924:Agbl1	UTSW	7	76409234	missense	probably benign	0.12
R6044:Agbl1	UTSW	7	76318120	missense	possibly damaging	0.56
R6117:Agbl1	UTSW	7	76698786	missense	probably damaging	1.00
R6144:Agbl1	UTSW	7	76420084	missense	probably benign	0.02
R6368:Agbl1	UTSW	7	76419830	missense	probably benign	0.25
R6806:Agbl1	UTSW	7	76425921	missense	probably damaging	1.00
R7455:Agbl1	UTSW	7	76424755	missense	unknown
R7459:Agbl1	UTSW	7	76420066	missense	not run
R7485:Agbl1	UTSW	7	76589493	missense	unknown
R7516:Agbl1	UTSW	7	76425921	missense	probably damaging	1.00
R7539:Agbl1	UTSW	7	76425929	critical splice donor site	probably null
R7561:Agbl1	UTSW	7	76698761	missense	unknown
R7630:Agbl1	UTSW	7	76886156	missense	unknown
R7655:Agbl1	UTSW	7	76409332	missense
R7656:Agbl1	UTSW	7	76409332	missense
R7658:Agbl1	UTSW	7	76766369	missense	unknown
R7681:Agbl1	UTSW	7	76444901	missense	unknown
R7694:Agbl1	UTSW	7	76698765	missense	unknown
R7773:Agbl1	UTSW	7	76698837	missense	unknown
Z1088:Agbl1	UTSW	7	76419904	missense	probably benign	0.00
Z1176:Agbl1	UTSW	7	76418685	missense
Z1177:Agbl1	UTSW	7	76720206	missense	unknown

Predicted Primers

PCR Primer
(F):5'- GCTCCTAAATCACAAGGGTCAC -3'
(R):5'- CCTGTTCTAAGGGAGCCTGAATG -3'

Sequencing Primer
(F):5'- CAAGGGTCACAAACAGCTAGTATAG -3'
(R):5'- ATGTCAGAGGTATCATGTCCAG -3'

Posted On

2014-09-17