Mutagenetix > Incidental Mutations

Incidental Mutation 'R2127:Hmbs'

227632

Institutional Source

Beutler Lab

Gene Symbol

Hmbs

Ensembl Gene

ENSMUSG00000032126

Gene Name

hydroxymethylbilane synthase

Synonyms

porphobilinogen deaminase, PBGD, Uros1, Ups

MMRRC Submission

040130-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2127 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

44336339-44344228 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 44340707 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 92 (T92A)

Ref Sequence

ENSEMBL: ENSMUSP00000095166 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000052686] [ENSMUST00000077353] [ENSMUST00000097558] [ENSMUST00000215091] [ENSMUST00000216852]

Predicted Effect

probably benign
Transcript: ENSMUST00000052686

SMART Domains

Protein: ENSMUSP00000051432
Gene: ENSMUSG00000049932

Domain	Start	End	E-Value	Type
H2A	3	123	1.64e-81	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000077353
AA Change: T109A

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000076575
Gene: ENSMUSG00000032126
AA Change: T109A

Domain	Start	End	E-Value	Type
Pfam:Porphobil_deam	21	233	1.7e-79	PFAM
Pfam:Porphobil_deamC	244	323	6.8e-24	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000097558
AA Change: T92A

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000095166
Gene: ENSMUSG00000032126
AA Change: T92A

Domain	Start	End	E-Value	Type
Pfam:Porphobil_deam	3	219	3.9e-95	PFAM
Pfam:Porphobil_deamC	227	327	4.7e-23	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000214012

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000214967

Predicted Effect

probably benign
Transcript: ENSMUST00000215091

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000215859

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000215934

Predicted Effect

probably benign
Transcript: ENSMUST00000216658

Predicted Effect

probably benign
Transcript: ENSMUST00000216852

Meta Mutation Damage Score

0.1699

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

98% (93/95)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the hydroxymethylbilane synthase superfamily. The encoded protein is the third enzyme of the heme biosynthetic pathway and catalyzes the head to tail condensation of four porphobilinogen molecules into the linear hydroxymethylbilane. Mutations in this gene are associated with the autosomal dominant disease acute intermittent porphyria. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous for one null allele and a functional allele with a milder mutation exhibit typical features of acute intermittent porphyria with massive urinary excretion of aminolevulinic acid after phenobarbital treatment, erythruria, ataxia, motor dysfunction, and neurologic muscle atrophy. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930449I24Rik	T	A	5: 146,504,942	S300T	possibly damaging	Het
4932431P20Rik	T	C	7: 29,537,140		noncoding transcript	Het
A2ml1	A	C	6: 128,558,437	V770G	probably damaging	Het
Abca6	A	G	11: 110,219,649	I558T	probably benign	Het
Abhd17c	C	A	7: 84,110,662	G295W	probably damaging	Het
Actn3	G	A	19: 4,871,675	A159V	probably damaging	Het
Adgrv1	A	T	13: 81,557,080	F1537Y	probably damaging	Het
Agbl1	G	T	7: 76,419,880	V373F	possibly damaging	Het
Aldh1a1	A	T	19: 20,642,915	E485D	probably benign	Het
Amdhd2	A	G	17: 24,158,308		probably null	Het
Armc3	A	G	2: 19,201,811	D15G	probably damaging	Het
Atp2b2	A	G	6: 113,760,650	L921P	probably damaging	Het
Btbd16	A	G	7: 130,784,308	N88S	probably benign	Het
Capn10	T	A	1: 92,938,034	C77*	probably null	Het
Caskin1	T	C	17: 24,496,996		probably null	Het
Catsper4	T	C	4: 134,213,806	D254G	probably benign	Het
Catsperg1	T	C	7: 29,185,040	D958G	probably damaging	Het
Ccar2	T	G	14: 70,139,651	K787Q	probably benign	Het
Ccdc191	C	T	16: 43,908,635	T244I	probably benign	Het
Cd33	A	T	7: 43,530,275	L243Q	possibly damaging	Het
Cdc37	T	C	9: 21,149,847	Y4C	probably damaging	Het
Cenpe	T	G	3: 135,239,780	N1018K	probably benign	Het
Crocc	G	A	4: 141,017,096	R1830C	probably damaging	Het
Csmd1	T	C	8: 15,917,392	D3157G	probably damaging	Het
Dhx57	C	T	17: 80,273,048	V492M	probably damaging	Het
Dnah2	A	T	11: 69,458,185	I2486N	probably benign	Het
Dnhd1	C	T	7: 105,693,721	T1424I	possibly damaging	Het
Dsc3	C	T	18: 19,968,354	A661T	probably benign	Het
F930015N05Rik	A	G	11: 64,435,403		probably benign	Het
Fbxo34	C	A	14: 47,530,106	R308S	probably damaging	Het
Gm10608	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	9: 119,160,716		probably benign	Het
Gm11595	A	T	11: 99,772,501	C118S	unknown	Het
Gm9742	A	T	13: 8,034,975		noncoding transcript	Het
Gmeb2	G	A	2: 181,259,049	A185V	probably benign	Het
Gpr15	A	G	16: 58,718,255	V157A	possibly damaging	Het
Gpr3	C	T	4: 133,210,621	A247T	probably damaging	Het
Grin2b	A	C	6: 135,778,700	S539A	probably benign	Het
Inpp4a	A	G	1: 37,366,919	M173V	probably benign	Het
Irx4	T	A	13: 73,265,476	S22T	probably benign	Het
Jph3	C	T	8: 121,785,142	A623V	probably benign	Het
Kif1b	G	A	4: 149,187,640	S1568L	possibly damaging	Het
Ksr1	G	A	11: 79,033,313	S361L	probably damaging	Het
Lyst	T	G	13: 13,635,262	Y506D	probably damaging	Het
Mctp1	A	G	13: 76,824,822	D648G	probably damaging	Het
Megf8	T	C	7: 25,364,582	S2788P	possibly damaging	Het
Mfsd2b	T	A	12: 4,867,659	Y129F	probably benign	Het
Mindy4	T	C	6: 55,218,265	S155P	probably benign	Het
Mospd4	A	G	18: 46,465,664		noncoding transcript	Het
Myo18b	A	T	5: 112,831,078	L1223Q	probably damaging	Het
Nckipsd	A	G	9: 108,811,733	T156A	probably benign	Het
Ndst1	G	A	18: 60,691,208	T799I	probably benign	Het
Npffr2	A	T	5: 89,568,065	I84F	probably damaging	Het
Nphp3	G	A	9: 104,008,243	V167M	probably damaging	Het
Nup107	C	A	10: 117,774,475	R354L	possibly damaging	Het
Olfml2a	T	C	2: 38,941,687	C93R	probably damaging	Het
Olfr1145	A	G	2: 87,810,341	I174V	probably benign	Het
Olfr1157	A	T	2: 87,962,832	V20D	probably benign	Het
Olfr384	C	G	11: 73,602,805	S75C	possibly damaging	Het
Pappa	T	A	4: 65,297,257	L1134M	probably damaging	Het
Plscr4	T	G	9: 92,488,630	F217V	possibly damaging	Het
Pnpla8	T	A	12: 44,308,057	Y667N	probably benign	Het
Polg	A	G	7: 79,464,928	L95P	probably damaging	Het
Psg20	T	G	7: 18,682,718	I158L	probably damaging	Het
Pwwp2a	A	G	11: 43,705,318	S437G	probably benign	Het
Rdx	A	G	9: 52,069,732	M305V	possibly damaging	Het
Rinl	A	G	7: 28,796,743	E383G	probably damaging	Het
Ror1	A	G	4: 100,442,093	M888V	probably benign	Het
Rps12	A	T	10: 23,786,878	I22K	possibly damaging	Het
Rtca	C	A	3: 116,497,674	R219L	possibly damaging	Het
Ryr2	G	A	13: 11,712,195	P2427S	probably damaging	Het
Slc10a6	A	G	5: 103,609,056	Y281H	probably benign	Het
Slc39a11	A	G	11: 113,369,803	S176P	probably benign	Het
Slfn10-ps	A	G	11: 83,030,342		noncoding transcript	Het
Spef2	T	C	15: 9,729,661	T124A	possibly damaging	Het
Sult2a4	G	T	7: 13,915,260	P207Q	probably damaging	Het
Tas1r3	G	A	4: 155,860,470	R765C	probably damaging	Het
Tcstv1	T	C	13: 119,893,746	T117A	probably damaging	Het
Tha1	A	G	11: 117,869,774	V208A	probably damaging	Het
Tmbim4	T	A	10: 120,224,753	I215N	probably damaging	Het
Tmem202	T	A	9: 59,520,200	I122F	probably benign	Het
Tomm70a	T	C	16: 57,121,871	S4P	unknown	Het
Tpcn2	A	G	7: 145,273,975		probably benign	Het
Trim36	A	T	18: 46,212,337	F10I	probably benign	Het
Usp30	A	G	5: 114,111,163	E176G	probably damaging	Het
Usp8	T	G	2: 126,737,575		probably null	Het
Vmn1r32	T	A	6: 66,553,549	Y81F	probably benign	Het
Vps36	G	T	8: 22,218,289		probably null	Het
Wnt3	A	G	11: 103,812,648	H319R	possibly damaging	Het
Zfp319	A	T	8: 95,323,763		probably benign	Het
Zfp408	T	C	2: 91,645,174	E545G	probably damaging	Het
Zfp799	C	T	17: 32,819,498	R598Q	possibly damaging	Het
Zfp831	T	C	2: 174,648,124	V1228A	probably benign	Het
Zfp938	T	C	10: 82,226,042	D248G	probably benign	Het

Other mutations in Hmbs

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01526:Hmbs	APN	9	44339548	missense	possibly damaging	0.91
IGL02312:Hmbs	APN	9	44341213	critical splice donor site	probably null
R0386:Hmbs	UTSW	9	44337008	missense	probably benign	0.06
R0411:Hmbs	UTSW	9	44341652	nonsense	probably null
R0656:Hmbs	UTSW	9	44337360	missense	probably benign	0.31
R1503:Hmbs	UTSW	9	44337432	missense	probably benign	0.42
R1560:Hmbs	UTSW	9	44337360	missense	possibly damaging	0.71
R1953:Hmbs	UTSW	9	44337444	missense	probably damaging	1.00
R4637:Hmbs	UTSW	9	44339537	missense	probably damaging	1.00
R5549:Hmbs	UTSW	9	44339477	critical splice donor site	probably null
R6611:Hmbs	UTSW	9	44341691	missense	probably damaging	0.98
R7509:Hmbs	UTSW	9	44336911	missense
X0024:Hmbs	UTSW	9	44337968	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- TGTCTGACAACCTTCAAAACAG -3'
(R):5'- TGGGGAATCAGACTGTCTGG -3'

Sequencing Primer
(F):5'- CCTTCAAAACAGAGGGCTAAGCG -3'
(R):5'- AAGAGACCAGGTCTTAGATCTTAAG -3'

Posted On

2014-09-17