Incidental Mutation 'R2127:Rdx'
ID 227633
Institutional Source Beutler Lab
Gene Symbol Rdx
Ensembl Gene ENSMUSG00000032050
Gene Name radixin
Synonyms
MMRRC Submission 040130-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2127 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 51958450-52000038 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 51981032 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 305 (M305V)
Ref Sequence ENSEMBL: ENSMUSP00000128249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000590] [ENSMUST00000061352] [ENSMUST00000163153]
AlphaFold P26043
PDB Structure CRYSTAL STRUCTURE OF THE RADIXIN FERM DOMAIN COMPLEXED WITH INOSITOL-(1,4,5)-TRIPHOSPHATE [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE RADIXIN FERM DOMAIN [X-RAY DIFFRACTION]
Crystal structure of the radxin FERM domain complexed with the ICAM-2 cytoplasmic peptide [X-RAY DIFFRACTION]
Crystal structure of the Radixin FERM domain complexed with the NHERF-1 C-terminal tail peptide [X-RAY DIFFRACTION]
Crystal structure of the Radixin FERM domain complexed with the NHERF-2 C-terminal tail peptide [X-RAY DIFFRACTION]
Crystal structure of the dimerized radixin FERM domain [X-RAY DIFFRACTION]
Crystal Structure Analysis of the radixin FERM domain complexed with adhesion molecule CD43 [X-RAY DIFFRACTION]
Crystal Structure Analysis of the radixin FERM domain complexed with adhesion molecule PSGL-1 [X-RAY DIFFRACTION]
Crystal structure of the Radixin FERM domain complexed with the NEP cytoplasmic tail [X-RAY DIFFRACTION]
Crystal structure of the mouse radxin FERM domain complexed with the mouse CD44 cytoplasmic peptide [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000000590
AA Change: M305V

PolyPhen 2 Score 0.489 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000000590
Gene: ENSMUSG00000032050
AA Change: M305V

DomainStartEndE-ValueType
B41 1 206 4.99e-82 SMART
FERM_C 210 299 1.43e-35 SMART
Pfam:ERM 338 583 6e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000061352
AA Change: M305V

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000055303
Gene: ENSMUSG00000032050
AA Change: M305V

DomainStartEndE-ValueType
B41 1 206 4.99e-82 SMART
FERM_C 210 299 1.43e-35 SMART
coiled coil region 300 365 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000163153
AA Change: M305V

PolyPhen 2 Score 0.489 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000128249
Gene: ENSMUSG00000032050
AA Change: M305V

DomainStartEndE-ValueType
B41 1 206 4.99e-82 SMART
FERM_C 210 299 1.43e-35 SMART
Pfam:ERM 338 583 3.4e-78 PFAM
Meta Mutation Damage Score 0.3445 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (93/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Radixin is a cytoskeletal protein that may be important in linking actin to the plasma membrane. It is highly similar in sequence to both ezrin and moesin. The radixin gene has been localized by fluorescence in situ hybridization to 11q23. A truncated version representing a pseudogene (RDXP2) was assigned to Xp21.3. Another pseudogene that seemed to lack introns (RDXP1) was mapped to 11p by Southern and PCR analyses. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a targeted mutation display mild degenerative changes in the liver and hyperbilirubinemia. Adult homozygotes exhibit profound deafness, but not imbalance, associated with progressive degeneration of stereocilia of cochlear hair cells after the onset of hearing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449I24Rik T A 5: 146,441,752 (GRCm39) S300T possibly damaging Het
A2ml1 A C 6: 128,535,400 (GRCm39) V770G probably damaging Het
Abca6 A G 11: 110,110,475 (GRCm39) I558T probably benign Het
Abhd17c C A 7: 83,759,870 (GRCm39) G295W probably damaging Het
Actn3 G A 19: 4,921,703 (GRCm39) A159V probably damaging Het
Adgrv1 A T 13: 81,705,199 (GRCm39) F1537Y probably damaging Het
Agbl1 G T 7: 76,069,628 (GRCm39) V373F possibly damaging Het
Aldh1a1 A T 19: 20,620,279 (GRCm39) E485D probably benign Het
Amdhd2 A G 17: 24,377,282 (GRCm39) probably null Het
Armc3 A G 2: 19,206,622 (GRCm39) D15G probably damaging Het
Atp2b2 A G 6: 113,737,611 (GRCm39) L921P probably damaging Het
Btbd16 A G 7: 130,386,038 (GRCm39) N88S probably benign Het
Capn10 T A 1: 92,865,756 (GRCm39) C77* probably null Het
Caskin1 T C 17: 24,715,970 (GRCm39) probably null Het
Catsper4 T C 4: 133,941,117 (GRCm39) D254G probably benign Het
Catsperg1 T C 7: 28,884,465 (GRCm39) D958G probably damaging Het
Ccar2 T G 14: 70,377,100 (GRCm39) K787Q probably benign Het
Ccdc191 C T 16: 43,728,998 (GRCm39) T244I probably benign Het
Cd33 A T 7: 43,179,699 (GRCm39) L243Q possibly damaging Het
Cdc37 T C 9: 21,061,143 (GRCm39) Y4C probably damaging Het
Cenpe T G 3: 134,945,541 (GRCm39) N1018K probably benign Het
Crocc G A 4: 140,744,407 (GRCm39) R1830C probably damaging Het
Csmd1 T C 8: 15,967,392 (GRCm39) D3157G probably damaging Het
Dhx57 C T 17: 80,580,477 (GRCm39) V492M probably damaging Het
Dnah2 A T 11: 69,349,011 (GRCm39) I2486N probably benign Het
Dnhd1 C T 7: 105,342,928 (GRCm39) T1424I possibly damaging Het
Dsc3 C T 18: 20,101,411 (GRCm39) A661T probably benign Het
F930015N05Rik A G 11: 64,326,229 (GRCm39) probably benign Het
Fbxo34 C A 14: 47,767,563 (GRCm39) R308S probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 118,989,784 (GRCm39) probably benign Het
Gm11595 A T 11: 99,663,327 (GRCm39) C118S unknown Het
Gm9742 A T 13: 8,085,011 (GRCm39) noncoding transcript Het
Gmeb2 G A 2: 180,900,842 (GRCm39) A185V probably benign Het
Gpr15 A G 16: 58,538,618 (GRCm39) V157A possibly damaging Het
Gpr3 C T 4: 132,937,932 (GRCm39) A247T probably damaging Het
Grin2b A C 6: 135,755,698 (GRCm39) S539A probably benign Het
Hmbs T C 9: 44,252,004 (GRCm39) T92A probably benign Het
Inpp4a A G 1: 37,406,000 (GRCm39) M173V probably benign Het
Irx4 T A 13: 73,413,595 (GRCm39) S22T probably benign Het
Jph3 C T 8: 122,511,881 (GRCm39) A623V probably benign Het
Kif1b G A 4: 149,272,097 (GRCm39) S1568L possibly damaging Het
Ksr1 G A 11: 78,924,139 (GRCm39) S361L probably damaging Het
Lyst T G 13: 13,809,847 (GRCm39) Y506D probably damaging Het
Mctp1 A G 13: 76,972,941 (GRCm39) D648G probably damaging Het
Megf8 T C 7: 25,064,007 (GRCm39) S2788P possibly damaging Het
Mfsd2b T A 12: 4,917,659 (GRCm39) Y129F probably benign Het
Mindy4 T C 6: 55,195,250 (GRCm39) S155P probably benign Het
Mospd4 A G 18: 46,598,731 (GRCm39) noncoding transcript Het
Myo18b A T 5: 112,978,944 (GRCm39) L1223Q probably damaging Het
Nckipsd A G 9: 108,688,932 (GRCm39) T156A probably benign Het
Ndst1 G A 18: 60,824,280 (GRCm39) T799I probably benign Het
Npffr2 A T 5: 89,715,924 (GRCm39) I84F probably damaging Het
Nphp3 G A 9: 103,885,442 (GRCm39) V167M probably damaging Het
Nup107 C A 10: 117,610,380 (GRCm39) R354L possibly damaging Het
Olfml2a T C 2: 38,831,699 (GRCm39) C93R probably damaging Het
Or12e10 A G 2: 87,640,685 (GRCm39) I174V probably benign Het
Or1e25 C G 11: 73,493,631 (GRCm39) S75C possibly damaging Het
Or5l14 A T 2: 87,793,176 (GRCm39) V20D probably benign Het
Pappa T A 4: 65,215,494 (GRCm39) L1134M probably damaging Het
Plscr4 T G 9: 92,370,683 (GRCm39) F217V possibly damaging Het
Pnpla8 T A 12: 44,354,840 (GRCm39) Y667N probably benign Het
Polg A G 7: 79,114,676 (GRCm39) L95P probably damaging Het
Psg20 T G 7: 18,416,643 (GRCm39) I158L probably damaging Het
Pwwp2a A G 11: 43,596,145 (GRCm39) S437G probably benign Het
Rinl A G 7: 28,496,168 (GRCm39) E383G probably damaging Het
Ror1 A G 4: 100,299,290 (GRCm39) M888V probably benign Het
Rps12 A T 10: 23,662,776 (GRCm39) I22K possibly damaging Het
Rtca C A 3: 116,291,323 (GRCm39) R219L possibly damaging Het
Ryr2 G A 13: 11,727,081 (GRCm39) P2427S probably damaging Het
Slc10a6 A G 5: 103,756,922 (GRCm39) Y281H probably benign Het
Slc39a11 A G 11: 113,260,629 (GRCm39) S176P probably benign Het
Slfn10-ps A G 11: 82,921,168 (GRCm39) noncoding transcript Het
Spef2 T C 15: 9,729,747 (GRCm39) T124A possibly damaging Het
Sult2a4 G T 7: 13,649,185 (GRCm39) P207Q probably damaging Het
Tas1r3 G A 4: 155,944,927 (GRCm39) R765C probably damaging Het
Tcstv1a T C 13: 120,355,282 (GRCm39) T117A probably damaging Het
Tha1 A G 11: 117,760,600 (GRCm39) V208A probably damaging Het
Tmbim4 T A 10: 120,060,658 (GRCm39) I215N probably damaging Het
Tmem202 T A 9: 59,427,483 (GRCm39) I122F probably benign Het
Tomm70a T C 16: 56,942,234 (GRCm39) S4P unknown Het
Tpcn2 A G 7: 144,827,712 (GRCm39) probably benign Het
Trim36 A T 18: 46,345,404 (GRCm39) F10I probably benign Het
Usp30 A G 5: 114,249,224 (GRCm39) E176G probably damaging Het
Usp8 T G 2: 126,579,495 (GRCm39) probably null Het
Vmn1r32 T A 6: 66,530,533 (GRCm39) Y81F probably benign Het
Vps36 G T 8: 22,708,305 (GRCm39) probably null Het
Wdr87-ps T C 7: 29,236,565 (GRCm39) noncoding transcript Het
Wnt3 A G 11: 103,703,474 (GRCm39) H319R possibly damaging Het
Zfp319 A T 8: 96,050,391 (GRCm39) probably benign Het
Zfp408 T C 2: 91,475,519 (GRCm39) E545G probably damaging Het
Zfp799 C T 17: 33,038,472 (GRCm39) R598Q possibly damaging Het
Zfp831 T C 2: 174,489,917 (GRCm39) V1228A probably benign Het
Zfp938 T C 10: 82,061,876 (GRCm39) D248G probably benign Het
Other mutations in Rdx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Rdx APN 9 51,997,646 (GRCm39) missense probably damaging 1.00
IGL02088:Rdx APN 9 51,972,183 (GRCm39) utr 5 prime probably benign
IGL02522:Rdx APN 9 51,979,504 (GRCm39) missense possibly damaging 0.92
R0731:Rdx UTSW 9 51,979,518 (GRCm39) missense probably benign 0.05
R0748:Rdx UTSW 9 51,976,160 (GRCm39) missense possibly damaging 0.87
R0831:Rdx UTSW 9 51,977,117 (GRCm39) missense probably damaging 1.00
R1605:Rdx UTSW 9 51,974,891 (GRCm39) missense probably damaging 1.00
R1688:Rdx UTSW 9 51,972,211 (GRCm39) splice site probably benign
R2363:Rdx UTSW 9 51,980,173 (GRCm39) missense probably damaging 1.00
R2899:Rdx UTSW 9 51,980,211 (GRCm39) splice site probably benign
R4184:Rdx UTSW 9 51,978,680 (GRCm39) missense probably damaging 1.00
R4569:Rdx UTSW 9 51,980,141 (GRCm39) missense probably benign 0.07
R4607:Rdx UTSW 9 51,980,137 (GRCm39) missense probably damaging 0.99
R4760:Rdx UTSW 9 51,977,174 (GRCm39) missense probably benign 0.02
R4820:Rdx UTSW 9 51,974,891 (GRCm39) missense probably damaging 1.00
R4966:Rdx UTSW 9 51,986,309 (GRCm39) missense probably benign 0.00
R6707:Rdx UTSW 9 51,974,954 (GRCm39) missense probably damaging 1.00
R7136:Rdx UTSW 9 51,997,745 (GRCm39) missense probably damaging 1.00
R7308:Rdx UTSW 9 51,980,170 (GRCm39) missense probably damaging 0.98
R7597:Rdx UTSW 9 51,972,196 (GRCm39) missense possibly damaging 0.84
R7835:Rdx UTSW 9 51,977,088 (GRCm39) missense probably damaging 0.98
R7923:Rdx UTSW 9 51,977,201 (GRCm39) missense possibly damaging 0.93
R8055:Rdx UTSW 9 51,997,724 (GRCm39) missense probably damaging 1.00
R8057:Rdx UTSW 9 51,976,946 (GRCm39) missense probably damaging 1.00
R8889:Rdx UTSW 9 51,997,753 (GRCm39) missense probably damaging 1.00
R8983:Rdx UTSW 9 51,974,905 (GRCm39) missense probably damaging 1.00
R9128:Rdx UTSW 9 51,976,179 (GRCm39) nonsense probably null
R9226:Rdx UTSW 9 51,992,468 (GRCm39) missense probably benign 0.01
R9377:Rdx UTSW 9 51,980,168 (GRCm39) missense possibly damaging 0.83
R9469:Rdx UTSW 9 51,977,069 (GRCm39) missense probably damaging 1.00
R9534:Rdx UTSW 9 51,984,482 (GRCm39) nonsense probably null
R9746:Rdx UTSW 9 51,974,878 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTGCAGTGACATCAGATTTCTAC -3'
(R):5'- CCTCACACTGCTCAAAAGGATG -3'

Sequencing Primer
(F):5'- CATGTTGAAATTGAGTAGCTGTGAAG -3'
(R):5'- GGATGAACCTGGTCCACTTC -3'
Posted On 2014-09-17