Incidental Mutation 'R2127:Nphp3'
ID227636
Institutional Source Beutler Lab
Gene Symbol Nphp3
Ensembl Gene ENSMUSG00000032558
Gene Namenephronophthisis 3 (adolescent)
Synonyms3632410F03Rik, D330020E01Rik, pcy, nephrocystin 3
MMRRC Submission 040130-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2127 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location104002544-104043818 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 104008243 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 167 (V167M)
Ref Sequence ENSEMBL: ENSMUSP00000141540 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035167] [ENSMUST00000193439] [ENSMUST00000194774]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035167
AA Change: V261M

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000035167
Gene: ENSMUSG00000032558
AA Change: V261M

DomainStartEndE-ValueType
low complexity region 46 69 N/A INTRINSIC
coiled coil region 107 203 N/A INTRINSIC
low complexity region 512 537 N/A INTRINSIC
low complexity region 613 627 N/A INTRINSIC
low complexity region 640 650 N/A INTRINSIC
TPR 938 971 3.16e1 SMART
TPR 980 1013 7.74e-2 SMART
TPR 1022 1055 3.24e1 SMART
low complexity region 1066 1080 N/A INTRINSIC
TPR 1088 1121 3.67e-3 SMART
TPR 1130 1163 1.3e-3 SMART
TPR 1172 1205 4.38e-1 SMART
TPR 1214 1247 8.69e-5 SMART
TPR 1256 1289 9.03e-3 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000116459
Gene: ENSMUSG00000032558
AA Change: V141M

DomainStartEndE-ValueType
coiled coil region 75 109 N/A INTRINSIC
low complexity region 418 443 N/A INTRINSIC
low complexity region 519 532 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191919
Predicted Effect probably damaging
Transcript: ENSMUST00000193439
AA Change: V167M

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000141540
Gene: ENSMUSG00000032558
AA Change: V167M

DomainStartEndE-ValueType
coiled coil region 75 109 N/A INTRINSIC
low complexity region 418 443 N/A INTRINSIC
low complexity region 519 532 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193642
Predicted Effect possibly damaging
Transcript: ENSMUST00000194774
AA Change: V141M

PolyPhen 2 Score 0.454 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000141596
Gene: ENSMUSG00000032558
AA Change: V141M

DomainStartEndE-ValueType
coiled coil region 49 83 N/A INTRINSIC
Pfam:NACHT 400 559 2e-6 PFAM
TPR 818 851 3.16e1 SMART
TPR 860 893 7.74e-2 SMART
TPR 902 935 3.24e1 SMART
low complexity region 946 960 N/A INTRINSIC
TPR 968 1001 3.67e-3 SMART
TPR 1010 1043 1.3e-3 SMART
TPR 1052 1085 4.38e-1 SMART
TPR 1094 1127 8.69e-5 SMART
TPR 1136 1169 9.03e-3 SMART
Meta Mutation Damage Score 0.0733 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (93/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a coiled-coil (CC) domain, a tubulin-tyrosine ligase (TTL) domain, and a tetratrico peptide repeat (TPR) domain. The encoded protein interacts with nephrocystin, it is required for normal ciliary development, and it functions in renal tubular development. Mutations in this gene are associated with nephronophthisis type 3, and also with renal-hepatic-pancreatic dysplasia, and Meckel syndrome type 7. Naturally occurring read-through transcripts exist between this gene and the downstream ACAD11 (acyl-CoA dehydrogenase family, member 11) gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous hypomorphic mice display slowly progressing kidney cysts, enlarged kidneys, increased blood urea nitrogen, kidney inflammation and associated fibrosis, and premature death. Homozygous null mice display mid gestational lethality with partial penetrance of situs inversus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449I24Rik T A 5: 146,504,942 S300T possibly damaging Het
4932431P20Rik T C 7: 29,537,140 noncoding transcript Het
A2ml1 A C 6: 128,558,437 V770G probably damaging Het
Abca6 A G 11: 110,219,649 I558T probably benign Het
Abhd17c C A 7: 84,110,662 G295W probably damaging Het
Actn3 G A 19: 4,871,675 A159V probably damaging Het
Adgrv1 A T 13: 81,557,080 F1537Y probably damaging Het
Agbl1 G T 7: 76,419,880 V373F possibly damaging Het
Aldh1a1 A T 19: 20,642,915 E485D probably benign Het
Amdhd2 A G 17: 24,158,308 probably null Het
Armc3 A G 2: 19,201,811 D15G probably damaging Het
Atp2b2 A G 6: 113,760,650 L921P probably damaging Het
Btbd16 A G 7: 130,784,308 N88S probably benign Het
Capn10 T A 1: 92,938,034 C77* probably null Het
Caskin1 T C 17: 24,496,996 probably null Het
Catsper4 T C 4: 134,213,806 D254G probably benign Het
Catsperg1 T C 7: 29,185,040 D958G probably damaging Het
Ccar2 T G 14: 70,139,651 K787Q probably benign Het
Ccdc191 C T 16: 43,908,635 T244I probably benign Het
Cd33 A T 7: 43,530,275 L243Q possibly damaging Het
Cdc37 T C 9: 21,149,847 Y4C probably damaging Het
Cenpe T G 3: 135,239,780 N1018K probably benign Het
Crocc G A 4: 141,017,096 R1830C probably damaging Het
Csmd1 T C 8: 15,917,392 D3157G probably damaging Het
Dhx57 C T 17: 80,273,048 V492M probably damaging Het
Dnah2 A T 11: 69,458,185 I2486N probably benign Het
Dnhd1 C T 7: 105,693,721 T1424I possibly damaging Het
Dsc3 C T 18: 19,968,354 A661T probably benign Het
F930015N05Rik A G 11: 64,435,403 probably benign Het
Fbxo34 C A 14: 47,530,106 R308S probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Gm11595 A T 11: 99,772,501 C118S unknown Het
Gm9742 A T 13: 8,034,975 noncoding transcript Het
Gmeb2 G A 2: 181,259,049 A185V probably benign Het
Gpr15 A G 16: 58,718,255 V157A possibly damaging Het
Gpr3 C T 4: 133,210,621 A247T probably damaging Het
Grin2b A C 6: 135,778,700 S539A probably benign Het
Hmbs T C 9: 44,340,707 T92A probably benign Het
Inpp4a A G 1: 37,366,919 M173V probably benign Het
Irx4 T A 13: 73,265,476 S22T probably benign Het
Jph3 C T 8: 121,785,142 A623V probably benign Het
Kif1b G A 4: 149,187,640 S1568L possibly damaging Het
Ksr1 G A 11: 79,033,313 S361L probably damaging Het
Lyst T G 13: 13,635,262 Y506D probably damaging Het
Mctp1 A G 13: 76,824,822 D648G probably damaging Het
Megf8 T C 7: 25,364,582 S2788P possibly damaging Het
Mfsd2b T A 12: 4,867,659 Y129F probably benign Het
Mindy4 T C 6: 55,218,265 S155P probably benign Het
Mospd4 A G 18: 46,465,664 noncoding transcript Het
Myo18b A T 5: 112,831,078 L1223Q probably damaging Het
Nckipsd A G 9: 108,811,733 T156A probably benign Het
Ndst1 G A 18: 60,691,208 T799I probably benign Het
Npffr2 A T 5: 89,568,065 I84F probably damaging Het
Nup107 C A 10: 117,774,475 R354L possibly damaging Het
Olfml2a T C 2: 38,941,687 C93R probably damaging Het
Olfr1145 A G 2: 87,810,341 I174V probably benign Het
Olfr1157 A T 2: 87,962,832 V20D probably benign Het
Olfr384 C G 11: 73,602,805 S75C possibly damaging Het
Pappa T A 4: 65,297,257 L1134M probably damaging Het
Plscr4 T G 9: 92,488,630 F217V possibly damaging Het
Pnpla8 T A 12: 44,308,057 Y667N probably benign Het
Polg A G 7: 79,464,928 L95P probably damaging Het
Psg20 T G 7: 18,682,718 I158L probably damaging Het
Pwwp2a A G 11: 43,705,318 S437G probably benign Het
Rdx A G 9: 52,069,732 M305V possibly damaging Het
Rinl A G 7: 28,796,743 E383G probably damaging Het
Ror1 A G 4: 100,442,093 M888V probably benign Het
Rps12 A T 10: 23,786,878 I22K possibly damaging Het
Rtca C A 3: 116,497,674 R219L possibly damaging Het
Ryr2 G A 13: 11,712,195 P2427S probably damaging Het
Slc10a6 A G 5: 103,609,056 Y281H probably benign Het
Slc39a11 A G 11: 113,369,803 S176P probably benign Het
Slfn10-ps A G 11: 83,030,342 noncoding transcript Het
Spef2 T C 15: 9,729,661 T124A possibly damaging Het
Sult2a4 G T 7: 13,915,260 P207Q probably damaging Het
Tas1r3 G A 4: 155,860,470 R765C probably damaging Het
Tcstv1 T C 13: 119,893,746 T117A probably damaging Het
Tha1 A G 11: 117,869,774 V208A probably damaging Het
Tmbim4 T A 10: 120,224,753 I215N probably damaging Het
Tmem202 T A 9: 59,520,200 I122F probably benign Het
Tomm70a T C 16: 57,121,871 S4P unknown Het
Tpcn2 A G 7: 145,273,975 probably benign Het
Trim36 A T 18: 46,212,337 F10I probably benign Het
Usp30 A G 5: 114,111,163 E176G probably damaging Het
Usp8 T G 2: 126,737,575 probably null Het
Vmn1r32 T A 6: 66,553,549 Y81F probably benign Het
Vps36 G T 8: 22,218,289 probably null Het
Wnt3 A G 11: 103,812,648 H319R possibly damaging Het
Zfp319 A T 8: 95,323,763 probably benign Het
Zfp408 T C 2: 91,645,174 E545G probably damaging Het
Zfp799 C T 17: 32,819,498 R598Q possibly damaging Het
Zfp831 T C 2: 174,648,124 V1228A probably benign Het
Zfp938 T C 10: 82,226,042 D248G probably benign Het
Other mutations in Nphp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01707:Nphp3 APN 9 104018158 missense possibly damaging 0.75
IGL02329:Nphp3 APN 9 104025968 missense probably benign 0.19
lithograph UTSW 9 104041990 missense probably damaging 1.00
F5770:Nphp3 UTSW 9 104035894 critical splice donor site probably null
FR4548:Nphp3 UTSW 9 104025939 small deletion probably benign
FR4589:Nphp3 UTSW 9 104025939 small deletion probably benign
R0112:Nphp3 UTSW 9 104037348 missense possibly damaging 0.80
R0555:Nphp3 UTSW 9 104023434 missense probably damaging 1.00
R0632:Nphp3 UTSW 9 104018274 missense probably damaging 1.00
R0674:Nphp3 UTSW 9 104036282 critical splice donor site probably null
R0743:Nphp3 UTSW 9 104022768 small deletion probably benign
R0853:Nphp3 UTSW 9 104031933 missense probably benign 0.03
R0920:Nphp3 UTSW 9 104031907 missense probably benign 0.00
R1420:Nphp3 UTSW 9 104035893 critical splice donor site probably null
R1464:Nphp3 UTSW 9 104031879 splice site probably benign
R1476:Nphp3 UTSW 9 104025927 missense possibly damaging 0.81
R1585:Nphp3 UTSW 9 104009214 missense probably damaging 1.00
R1608:Nphp3 UTSW 9 104035840 missense probably benign 0.30
R1688:Nphp3 UTSW 9 104003124 missense probably damaging 1.00
R1691:Nphp3 UTSW 9 104002811 missense probably benign
R1807:Nphp3 UTSW 9 104020741 missense probably benign 0.01
R1857:Nphp3 UTSW 9 104021294 missense possibly damaging 0.87
R1962:Nphp3 UTSW 9 104021338 missense probably benign 0.00
R2138:Nphp3 UTSW 9 104025903 missense possibly damaging 0.89
R2233:Nphp3 UTSW 9 104037376 missense probably benign 0.02
R2234:Nphp3 UTSW 9 104037376 missense probably benign 0.02
R3861:Nphp3 UTSW 9 104039326 unclassified probably benign
R3928:Nphp3 UTSW 9 104011730 missense probably damaging 0.99
R3961:Nphp3 UTSW 9 104003042 nonsense probably null
R4182:Nphp3 UTSW 9 104038464 missense probably benign 0.06
R4294:Nphp3 UTSW 9 104022717 missense probably damaging 1.00
R4387:Nphp3 UTSW 9 104030020 missense possibly damaging 0.94
R4625:Nphp3 UTSW 9 104036159 missense possibly damaging 0.66
R4628:Nphp3 UTSW 9 104003058 missense probably damaging 0.99
R4696:Nphp3 UTSW 9 104022732 missense probably benign 0.01
R4865:Nphp3 UTSW 9 104031970 missense probably benign
R4886:Nphp3 UTSW 9 104002994 missense probably damaging 1.00
R4973:Nphp3 UTSW 9 104031999 missense probably benign
R5445:Nphp3 UTSW 9 104004723 missense probably damaging 1.00
R5451:Nphp3 UTSW 9 104042022 missense probably benign
R5520:Nphp3 UTSW 9 104024673 missense probably benign 0.30
R5641:Nphp3 UTSW 9 104036153 missense probably damaging 1.00
R5847:Nphp3 UTSW 9 104003037 missense probably damaging 1.00
R5928:Nphp3 UTSW 9 104035797 missense probably benign 0.01
R5931:Nphp3 UTSW 9 104020746 missense probably damaging 1.00
R6161:Nphp3 UTSW 9 104031906 missense probably benign 0.11
R6298:Nphp3 UTSW 9 104015441 missense probably damaging 1.00
R6890:Nphp3 UTSW 9 104041954 missense probably damaging 0.96
R7009:Nphp3 UTSW 9 104016116 missense probably null 0.00
R7065:Nphp3 UTSW 9 104041990 missense probably damaging 1.00
R7146:Nphp3 UTSW 9 104004837 nonsense probably null
R7198:Nphp3 UTSW 9 104004775 missense probably damaging 1.00
R7360:Nphp3 UTSW 9 104016078 critical splice acceptor site probably null
R7369:Nphp3 UTSW 9 104018250 missense probably damaging 0.99
R7554:Nphp3 UTSW 9 104042071 missense probably damaging 0.98
R7591:Nphp3 UTSW 9 104018278 critical splice donor site probably null
R7672:Nphp3 UTSW 9 104031960 missense probably benign
R7675:Nphp3 UTSW 9 104016088 missense probably benign
V7583:Nphp3 UTSW 9 104035894 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACCCCTATTTGGCATATGTGG -3'
(R):5'- GAACCACGTTATCCTGATGAGAAG -3'

Sequencing Primer
(F):5'- TGGCATATGTGGAGAGTTTTTAAAC -3'
(R):5'- CCTGATGAGAAGGATGTAGTCTC -3'
Posted On2014-09-17