Mutagenetix > Incidental Mutation

Incidental Mutation 'R2127:Rps12'

227639

Institutional Source

Beutler Lab

Gene Symbol

Rps12

Ensembl Gene

ENSMUSG00000061983

Gene Name

ribosomal protein S12

Synonyms

MMRRC Submission

040130-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2127 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

23785183-23787275 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 23786878 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Lysine at position 22 (I22K)

Ref Sequence

ENSEMBL: ENSMUSP00000151586 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000073926] [ENSMUST00000218107] [ENSMUST00000218221] [ENSMUST00000220070]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000073926
AA Change: I6K

PolyPhen 2 Score 0.282 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000073581
Gene: ENSMUSG00000061983
AA Change: I6K

Domain	Start	End	E-Value	Type
Pfam:Ribosomal_L7Ae	16	111	2.7e-32	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000093556

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000104252

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000116836

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000217883

Predicted Effect

probably benign
Transcript: ENSMUST00000218107
AA Change: I6K

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)

Predicted Effect

probably benign
Transcript: ENSMUST00000218142

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218185

Predicted Effect

possibly damaging
Transcript: ENSMUST00000218221
AA Change: I22K

PolyPhen 2 Score 0.746 (Sensitivity: 0.85; Specificity: 0.92)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219783

Predicted Effect

probably benign
Transcript: ENSMUST00000220070
AA Change: I6K

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220171

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

98% (93/95)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S12E family of ribosomal proteins. It is located in the cytoplasm. Increased expression of this gene in colorectal cancers compared to matched normal colonic mucosa has been observed. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930449I24Rik	T	A	5: 146,504,942	S300T	possibly damaging	Het
4932431P20Rik	T	C	7: 29,537,140		noncoding transcript	Het
A2ml1	A	C	6: 128,558,437	V770G	probably damaging	Het
Abca6	A	G	11: 110,219,649	I558T	probably benign	Het
Abhd17c	C	A	7: 84,110,662	G295W	probably damaging	Het
Actn3	G	A	19: 4,871,675	A159V	probably damaging	Het
Adgrv1	A	T	13: 81,557,080	F1537Y	probably damaging	Het
Agbl1	G	T	7: 76,419,880	V373F	possibly damaging	Het
Aldh1a1	A	T	19: 20,642,915	E485D	probably benign	Het
Amdhd2	A	G	17: 24,158,308		probably null	Het
Armc3	A	G	2: 19,201,811	D15G	probably damaging	Het
Atp2b2	A	G	6: 113,760,650	L921P	probably damaging	Het
Btbd16	A	G	7: 130,784,308	N88S	probably benign	Het
Capn10	T	A	1: 92,938,034	C77*	probably null	Het
Caskin1	T	C	17: 24,496,996		probably null	Het
Catsper4	T	C	4: 134,213,806	D254G	probably benign	Het
Catsperg1	T	C	7: 29,185,040	D958G	probably damaging	Het
Ccar2	T	G	14: 70,139,651	K787Q	probably benign	Het
Ccdc191	C	T	16: 43,908,635	T244I	probably benign	Het
Cd33	A	T	7: 43,530,275	L243Q	possibly damaging	Het
Cdc37	T	C	9: 21,149,847	Y4C	probably damaging	Het
Cenpe	T	G	3: 135,239,780	N1018K	probably benign	Het
Crocc	G	A	4: 141,017,096	R1830C	probably damaging	Het
Csmd1	T	C	8: 15,917,392	D3157G	probably damaging	Het
Dhx57	C	T	17: 80,273,048	V492M	probably damaging	Het
Dnah2	A	T	11: 69,458,185	I2486N	probably benign	Het
Dnhd1	C	T	7: 105,693,721	T1424I	possibly damaging	Het
Dsc3	C	T	18: 19,968,354	A661T	probably benign	Het
F930015N05Rik	A	G	11: 64,435,403		probably benign	Het
Fbxo34	C	A	14: 47,530,106	R308S	probably damaging	Het
Gm10608	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	9: 119,160,716		probably benign	Het
Gm11595	A	T	11: 99,772,501	C118S	unknown	Het
Gm9742	A	T	13: 8,034,975		noncoding transcript	Het
Gmeb2	G	A	2: 181,259,049	A185V	probably benign	Het
Gpr15	A	G	16: 58,718,255	V157A	possibly damaging	Het
Gpr3	C	T	4: 133,210,621	A247T	probably damaging	Het
Grin2b	A	C	6: 135,778,700	S539A	probably benign	Het
Hmbs	T	C	9: 44,340,707	T92A	probably benign	Het
Inpp4a	A	G	1: 37,366,919	M173V	probably benign	Het
Irx4	T	A	13: 73,265,476	S22T	probably benign	Het
Jph3	C	T	8: 121,785,142	A623V	probably benign	Het
Kif1b	G	A	4: 149,187,640	S1568L	possibly damaging	Het
Ksr1	G	A	11: 79,033,313	S361L	probably damaging	Het
Lyst	T	G	13: 13,635,262	Y506D	probably damaging	Het
Mctp1	A	G	13: 76,824,822	D648G	probably damaging	Het
Megf8	T	C	7: 25,364,582	S2788P	possibly damaging	Het
Mfsd2b	T	A	12: 4,867,659	Y129F	probably benign	Het
Mindy4	T	C	6: 55,218,265	S155P	probably benign	Het
Mospd4	A	G	18: 46,465,664		noncoding transcript	Het
Myo18b	A	T	5: 112,831,078	L1223Q	probably damaging	Het
Nckipsd	A	G	9: 108,811,733	T156A	probably benign	Het
Ndst1	G	A	18: 60,691,208	T799I	probably benign	Het
Npffr2	A	T	5: 89,568,065	I84F	probably damaging	Het
Nphp3	G	A	9: 104,008,243	V167M	probably damaging	Het
Nup107	C	A	10: 117,774,475	R354L	possibly damaging	Het
Olfml2a	T	C	2: 38,941,687	C93R	probably damaging	Het
Olfr1145	A	G	2: 87,810,341	I174V	probably benign	Het
Olfr1157	A	T	2: 87,962,832	V20D	probably benign	Het
Olfr384	C	G	11: 73,602,805	S75C	possibly damaging	Het
Pappa	T	A	4: 65,297,257	L1134M	probably damaging	Het
Plscr4	T	G	9: 92,488,630	F217V	possibly damaging	Het
Pnpla8	T	A	12: 44,308,057	Y667N	probably benign	Het
Polg	A	G	7: 79,464,928	L95P	probably damaging	Het
Psg20	T	G	7: 18,682,718	I158L	probably damaging	Het
Pwwp2a	A	G	11: 43,705,318	S437G	probably benign	Het
Rdx	A	G	9: 52,069,732	M305V	possibly damaging	Het
Rinl	A	G	7: 28,796,743	E383G	probably damaging	Het
Ror1	A	G	4: 100,442,093	M888V	probably benign	Het
Rtca	C	A	3: 116,497,674	R219L	possibly damaging	Het
Ryr2	G	A	13: 11,712,195	P2427S	probably damaging	Het
Slc10a6	A	G	5: 103,609,056	Y281H	probably benign	Het
Slc39a11	A	G	11: 113,369,803	S176P	probably benign	Het
Slfn10-ps	A	G	11: 83,030,342		noncoding transcript	Het
Spef2	T	C	15: 9,729,661	T124A	possibly damaging	Het
Sult2a4	G	T	7: 13,915,260	P207Q	probably damaging	Het
Tas1r3	G	A	4: 155,860,470	R765C	probably damaging	Het
Tcstv1	T	C	13: 119,893,746	T117A	probably damaging	Het
Tha1	A	G	11: 117,869,774	V208A	probably damaging	Het
Tmbim4	T	A	10: 120,224,753	I215N	probably damaging	Het
Tmem202	T	A	9: 59,520,200	I122F	probably benign	Het
Tomm70a	T	C	16: 57,121,871	S4P	unknown	Het
Tpcn2	A	G	7: 145,273,975		probably benign	Het
Trim36	A	T	18: 46,212,337	F10I	probably benign	Het
Usp30	A	G	5: 114,111,163	E176G	probably damaging	Het
Usp8	T	G	2: 126,737,575		probably null	Het
Vmn1r32	T	A	6: 66,553,549	Y81F	probably benign	Het
Vps36	G	T	8: 22,218,289		probably null	Het
Wnt3	A	G	11: 103,812,648	H319R	possibly damaging	Het
Zfp319	A	T	8: 95,323,763		probably benign	Het
Zfp408	T	C	2: 91,645,174	E545G	probably damaging	Het
Zfp799	C	T	17: 32,819,498	R598Q	possibly damaging	Het
Zfp831	T	C	2: 174,648,124	V1228A	probably benign	Het
Zfp938	T	C	10: 82,226,042	D248G	probably benign	Het

Other mutations in Rps12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R0144:Rps12	UTSW	10	23786791	missense	probably benign	0.09
R1836:Rps12	UTSW	10	23785629	missense	probably damaging	1.00
R4782:Rps12	UTSW	10	23786790	missense	possibly damaging	0.62
R7201:Rps12	UTSW	10	23785231	missense	probably benign	0.01
R7723:Rps12	UTSW	10	23786854	missense	probably benign	0.10
R8079:Rps12	UTSW	10	23785677	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TGGCCGGATGACATTCAGAAC -3'
(R):5'- CAGTGCGTTCAAGATTCGG -3'

Sequencing Primer
(F):5'- GCCGGATGACATTCAGAACTTTTG -3'
(R):5'- GTTCAAGATTCGGCGTCAC -3'

Posted On

2014-09-17