Incidental Mutation 'R2127:Nup107'
ID227641
Institutional Source Beutler Lab
Gene Symbol Nup107
Ensembl Gene ENSMUSG00000052798
Gene Namenucleoporin 107
Synonyms
MMRRC Submission 040130-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R2127 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location117750621-117792705 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 117774475 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 354 (R354L)
Ref Sequence ENSEMBL: ENSMUSP00000129546 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064848] [ENSMUST00000167943] [ENSMUST00000218576]
Predicted Effect possibly damaging
Transcript: ENSMUST00000064848
AA Change: R356L

PolyPhen 2 Score 0.691 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000063590
Gene: ENSMUSG00000052798
AA Change: R356L

DomainStartEndE-ValueType
Pfam:Nup84_Nup100 210 909 2.2e-218 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000167943
AA Change: R354L

PolyPhen 2 Score 0.691 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000129546
Gene: ENSMUSG00000052798
AA Change: R354L

DomainStartEndE-ValueType
Pfam:Nup84_Nup100 206 909 2.4e-226 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218576
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218777
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218810
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220323
Meta Mutation Damage Score 0.8994 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (93/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nucleoporin family. The protein is localized to the nuclear rim and is an essential component of the nuclear pore complex (NPC). All molecules entering or leaving the nucleus either diffuse through or are actively transported by the NPC. Alternate transcriptional splice variants of this gene have been observed but have not been thoroughly characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a CRISPR-generated allele exhibit reduced female fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449I24Rik T A 5: 146,504,942 S300T possibly damaging Het
4932431P20Rik T C 7: 29,537,140 noncoding transcript Het
A2ml1 A C 6: 128,558,437 V770G probably damaging Het
Abca6 A G 11: 110,219,649 I558T probably benign Het
Abhd17c C A 7: 84,110,662 G295W probably damaging Het
Actn3 G A 19: 4,871,675 A159V probably damaging Het
Adgrv1 A T 13: 81,557,080 F1537Y probably damaging Het
Agbl1 G T 7: 76,419,880 V373F possibly damaging Het
Aldh1a1 A T 19: 20,642,915 E485D probably benign Het
Amdhd2 A G 17: 24,158,308 probably null Het
Armc3 A G 2: 19,201,811 D15G probably damaging Het
Atp2b2 A G 6: 113,760,650 L921P probably damaging Het
Btbd16 A G 7: 130,784,308 N88S probably benign Het
Capn10 T A 1: 92,938,034 C77* probably null Het
Caskin1 T C 17: 24,496,996 probably null Het
Catsper4 T C 4: 134,213,806 D254G probably benign Het
Catsperg1 T C 7: 29,185,040 D958G probably damaging Het
Ccar2 T G 14: 70,139,651 K787Q probably benign Het
Ccdc191 C T 16: 43,908,635 T244I probably benign Het
Cd33 A T 7: 43,530,275 L243Q possibly damaging Het
Cdc37 T C 9: 21,149,847 Y4C probably damaging Het
Cenpe T G 3: 135,239,780 N1018K probably benign Het
Crocc G A 4: 141,017,096 R1830C probably damaging Het
Csmd1 T C 8: 15,917,392 D3157G probably damaging Het
Dhx57 C T 17: 80,273,048 V492M probably damaging Het
Dnah2 A T 11: 69,458,185 I2486N probably benign Het
Dnhd1 C T 7: 105,693,721 T1424I possibly damaging Het
Dsc3 C T 18: 19,968,354 A661T probably benign Het
F930015N05Rik A G 11: 64,435,403 probably benign Het
Fbxo34 C A 14: 47,530,106 R308S probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Gm11595 A T 11: 99,772,501 C118S unknown Het
Gm9742 A T 13: 8,034,975 noncoding transcript Het
Gmeb2 G A 2: 181,259,049 A185V probably benign Het
Gpr15 A G 16: 58,718,255 V157A possibly damaging Het
Gpr3 C T 4: 133,210,621 A247T probably damaging Het
Grin2b A C 6: 135,778,700 S539A probably benign Het
Hmbs T C 9: 44,340,707 T92A probably benign Het
Inpp4a A G 1: 37,366,919 M173V probably benign Het
Irx4 T A 13: 73,265,476 S22T probably benign Het
Jph3 C T 8: 121,785,142 A623V probably benign Het
Kif1b G A 4: 149,187,640 S1568L possibly damaging Het
Ksr1 G A 11: 79,033,313 S361L probably damaging Het
Lyst T G 13: 13,635,262 Y506D probably damaging Het
Mctp1 A G 13: 76,824,822 D648G probably damaging Het
Megf8 T C 7: 25,364,582 S2788P possibly damaging Het
Mfsd2b T A 12: 4,867,659 Y129F probably benign Het
Mindy4 T C 6: 55,218,265 S155P probably benign Het
Mospd4 A G 18: 46,465,664 noncoding transcript Het
Myo18b A T 5: 112,831,078 L1223Q probably damaging Het
Nckipsd A G 9: 108,811,733 T156A probably benign Het
Ndst1 G A 18: 60,691,208 T799I probably benign Het
Npffr2 A T 5: 89,568,065 I84F probably damaging Het
Nphp3 G A 9: 104,008,243 V167M probably damaging Het
Olfml2a T C 2: 38,941,687 C93R probably damaging Het
Olfr1145 A G 2: 87,810,341 I174V probably benign Het
Olfr1157 A T 2: 87,962,832 V20D probably benign Het
Olfr384 C G 11: 73,602,805 S75C possibly damaging Het
Pappa T A 4: 65,297,257 L1134M probably damaging Het
Plscr4 T G 9: 92,488,630 F217V possibly damaging Het
Pnpla8 T A 12: 44,308,057 Y667N probably benign Het
Polg A G 7: 79,464,928 L95P probably damaging Het
Psg20 T G 7: 18,682,718 I158L probably damaging Het
Pwwp2a A G 11: 43,705,318 S437G probably benign Het
Rdx A G 9: 52,069,732 M305V possibly damaging Het
Rinl A G 7: 28,796,743 E383G probably damaging Het
Ror1 A G 4: 100,442,093 M888V probably benign Het
Rps12 A T 10: 23,786,878 I22K possibly damaging Het
Rtca C A 3: 116,497,674 R219L possibly damaging Het
Ryr2 G A 13: 11,712,195 P2427S probably damaging Het
Slc10a6 A G 5: 103,609,056 Y281H probably benign Het
Slc39a11 A G 11: 113,369,803 S176P probably benign Het
Slfn10-ps A G 11: 83,030,342 noncoding transcript Het
Spef2 T C 15: 9,729,661 T124A possibly damaging Het
Sult2a4 G T 7: 13,915,260 P207Q probably damaging Het
Tas1r3 G A 4: 155,860,470 R765C probably damaging Het
Tcstv1 T C 13: 119,893,746 T117A probably damaging Het
Tha1 A G 11: 117,869,774 V208A probably damaging Het
Tmbim4 T A 10: 120,224,753 I215N probably damaging Het
Tmem202 T A 9: 59,520,200 I122F probably benign Het
Tomm70a T C 16: 57,121,871 S4P unknown Het
Tpcn2 A G 7: 145,273,975 probably benign Het
Trim36 A T 18: 46,212,337 F10I probably benign Het
Usp30 A G 5: 114,111,163 E176G probably damaging Het
Usp8 T G 2: 126,737,575 probably null Het
Vmn1r32 T A 6: 66,553,549 Y81F probably benign Het
Vps36 G T 8: 22,218,289 probably null Het
Wnt3 A G 11: 103,812,648 H319R possibly damaging Het
Zfp319 A T 8: 95,323,763 probably benign Het
Zfp408 T C 2: 91,645,174 E545G probably damaging Het
Zfp799 C T 17: 32,819,498 R598Q possibly damaging Het
Zfp831 T C 2: 174,648,124 V1228A probably benign Het
Zfp938 T C 10: 82,226,042 D248G probably benign Het
Other mutations in Nup107
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00590:Nup107 APN 10 117763803 missense probably damaging 1.00
IGL00595:Nup107 APN 10 117773352 nonsense probably null
IGL00595:Nup107 APN 10 117773368 critical splice acceptor site probably null
IGL01120:Nup107 APN 10 117770241 splice site probably benign
IGL01420:Nup107 APN 10 117785021 missense probably damaging 1.00
IGL01646:Nup107 APN 10 117781342 missense probably damaging 1.00
IGL01748:Nup107 APN 10 117757274 missense probably benign 0.06
IGL01755:Nup107 APN 10 117774493 missense probably damaging 1.00
IGL01982:Nup107 APN 10 117759340 splice site probably benign
IGL03394:Nup107 APN 10 117782028 missense probably damaging 0.96
R0371:Nup107 UTSW 10 117763769 missense probably damaging 0.98
R1036:Nup107 UTSW 10 117757294 missense probably damaging 0.98
R1186:Nup107 UTSW 10 117777146 nonsense probably null
R1538:Nup107 UTSW 10 117790494 missense probably damaging 0.96
R1555:Nup107 UTSW 10 117751490 splice site probably benign
R1570:Nup107 UTSW 10 117763844 missense possibly damaging 0.49
R1758:Nup107 UTSW 10 117761343 missense probably damaging 1.00
R1856:Nup107 UTSW 10 117750906 missense probably damaging 1.00
R2105:Nup107 UTSW 10 117773320 missense probably damaging 1.00
R4480:Nup107 UTSW 10 117761332 missense probably benign 0.00
R4540:Nup107 UTSW 10 117762020 splice site probably null
R4584:Nup107 UTSW 10 117766368 missense probably benign 0.05
R4878:Nup107 UTSW 10 117751418 missense probably benign 0.17
R4887:Nup107 UTSW 10 117770478 missense probably damaging 1.00
R4921:Nup107 UTSW 10 117770511 missense possibly damaging 0.95
R5960:Nup107 UTSW 10 117790010 missense probably null
R5986:Nup107 UTSW 10 117759176 missense probably damaging 1.00
R6947:Nup107 UTSW 10 117757274 missense probably benign 0.06
R7092:Nup107 UTSW 10 117790494 missense probably damaging 0.96
R7165:Nup107 UTSW 10 117773362 missense probably damaging 0.98
R7190:Nup107 UTSW 10 117762135 missense probably benign
R7331:Nup107 UTSW 10 117770198 missense probably damaging 0.99
R7405:Nup107 UTSW 10 117770415 missense probably benign 0.02
R7596:Nup107 UTSW 10 117777160 missense probably damaging 1.00
R7644:Nup107 UTSW 10 117770470 missense probably damaging 1.00
R7734:Nup107 UTSW 10 117758012 nonsense probably null
R7998:Nup107 UTSW 10 117757994 missense probably damaging 1.00
R8060:Nup107 UTSW 10 117763769 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCTGAAGAATCTGCTAAGAGCTC -3'
(R):5'- CGTATGCATGATCCGCTAAGG -3'

Sequencing Primer
(F):5'- TCTGCTAAGAGCTCTGGAAAC -3'
(R):5'- CCGCTAAGGTAGAAAATAATGACTAC -3'
Posted On2014-09-17