Incidental Mutation 'R2127:Dnah2'
ID227645
Institutional Source Beutler Lab
Gene Symbol Dnah2
Ensembl Gene ENSMUSG00000005237
Gene Namedynein, axonemal, heavy chain 2
SynonymsDnahc2, Dnhd3, D330014H01Rik, 2900022L05Rik
MMRRC Submission 040130-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2127 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location69420809-69549110 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 69458185 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 2486 (I2486N)
Ref Sequence ENSEMBL: ENSMUSP00000047329 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035539] [ENSMUST00000108659]
Predicted Effect probably benign
Transcript: ENSMUST00000035539
AA Change: I2486N

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000047329
Gene: ENSMUSG00000005237
AA Change: I2486N

DomainStartEndE-ValueType
low complexity region 4 25 N/A INTRINSIC
Pfam:DHC_N1 273 429 6.6e-37 PFAM
Pfam:DHC_N1 432 761 1.3e-54 PFAM
Pfam:DHC_N2 1253 1668 3.4e-144 PFAM
AAA 1826 1962 2.95e-1 SMART
Pfam:AAA_5 2108 2251 1.3e-5 PFAM
AAA 2437 2584 3.63e-5 SMART
Pfam:AAA_8 2752 3022 1.1e-75 PFAM
Pfam:MT 3034 3370 8.7e-55 PFAM
Pfam:AAA_9 3386 3616 7.4e-68 PFAM
Pfam:Dynein_heavy 3748 4453 1.2e-220 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108659
AA Change: I2492N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104299
Gene: ENSMUSG00000005237
AA Change: I2492N

DomainStartEndE-ValueType
low complexity region 4 25 N/A INTRINSIC
Pfam:DHC_N1 274 429 1.1e-47 PFAM
Pfam:DHC_N1 438 760 1.5e-75 PFAM
Pfam:DHC_N2 1255 1666 4.4e-144 PFAM
low complexity region 1711 1720 N/A INTRINSIC
AAA 1832 1968 2.95e-1 SMART
Blast:AAA 2111 2251 2e-86 BLAST
AAA 2443 2590 3.63e-5 SMART
Pfam:AAA_8 2758 3028 5.5e-77 PFAM
Pfam:MT 3040 3376 7.6e-55 PFAM
Pfam:AAA_9 3396 3621 7.5e-94 PFAM
Pfam:Dynein_heavy 3759 4458 4.9e-264 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124108
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (93/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. The axonemal dyneins, found in cilia and flagella, are components of the outer and inner dynein arms attached to the peripheral microtubule doublets. DNAH2 is an axonemal inner arm dynein heavy chain (Chapelin et al., 1997 [PubMed 9256245]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449I24Rik T A 5: 146,504,942 S300T possibly damaging Het
4932431P20Rik T C 7: 29,537,140 noncoding transcript Het
A2ml1 A C 6: 128,558,437 V770G probably damaging Het
Abca6 A G 11: 110,219,649 I558T probably benign Het
Abhd17c C A 7: 84,110,662 G295W probably damaging Het
Actn3 G A 19: 4,871,675 A159V probably damaging Het
Adgrv1 A T 13: 81,557,080 F1537Y probably damaging Het
Agbl1 G T 7: 76,419,880 V373F possibly damaging Het
Aldh1a1 A T 19: 20,642,915 E485D probably benign Het
Amdhd2 A G 17: 24,158,308 probably null Het
Armc3 A G 2: 19,201,811 D15G probably damaging Het
Atp2b2 A G 6: 113,760,650 L921P probably damaging Het
Btbd16 A G 7: 130,784,308 N88S probably benign Het
Capn10 T A 1: 92,938,034 C77* probably null Het
Caskin1 T C 17: 24,496,996 probably null Het
Catsper4 T C 4: 134,213,806 D254G probably benign Het
Catsperg1 T C 7: 29,185,040 D958G probably damaging Het
Ccar2 T G 14: 70,139,651 K787Q probably benign Het
Ccdc191 C T 16: 43,908,635 T244I probably benign Het
Cd33 A T 7: 43,530,275 L243Q possibly damaging Het
Cdc37 T C 9: 21,149,847 Y4C probably damaging Het
Cenpe T G 3: 135,239,780 N1018K probably benign Het
Crocc G A 4: 141,017,096 R1830C probably damaging Het
Csmd1 T C 8: 15,917,392 D3157G probably damaging Het
Dhx57 C T 17: 80,273,048 V492M probably damaging Het
Dnhd1 C T 7: 105,693,721 T1424I possibly damaging Het
Dsc3 C T 18: 19,968,354 A661T probably benign Het
F930015N05Rik A G 11: 64,435,403 probably benign Het
Fbxo34 C A 14: 47,530,106 R308S probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Gm11595 A T 11: 99,772,501 C118S unknown Het
Gm9742 A T 13: 8,034,975 noncoding transcript Het
Gmeb2 G A 2: 181,259,049 A185V probably benign Het
Gpr15 A G 16: 58,718,255 V157A possibly damaging Het
Gpr3 C T 4: 133,210,621 A247T probably damaging Het
Grin2b A C 6: 135,778,700 S539A probably benign Het
Hmbs T C 9: 44,340,707 T92A probably benign Het
Inpp4a A G 1: 37,366,919 M173V probably benign Het
Irx4 T A 13: 73,265,476 S22T probably benign Het
Jph3 C T 8: 121,785,142 A623V probably benign Het
Kif1b G A 4: 149,187,640 S1568L possibly damaging Het
Ksr1 G A 11: 79,033,313 S361L probably damaging Het
Lyst T G 13: 13,635,262 Y506D probably damaging Het
Mctp1 A G 13: 76,824,822 D648G probably damaging Het
Megf8 T C 7: 25,364,582 S2788P possibly damaging Het
Mfsd2b T A 12: 4,867,659 Y129F probably benign Het
Mindy4 T C 6: 55,218,265 S155P probably benign Het
Mospd4 A G 18: 46,465,664 noncoding transcript Het
Myo18b A T 5: 112,831,078 L1223Q probably damaging Het
Nckipsd A G 9: 108,811,733 T156A probably benign Het
Ndst1 G A 18: 60,691,208 T799I probably benign Het
Npffr2 A T 5: 89,568,065 I84F probably damaging Het
Nphp3 G A 9: 104,008,243 V167M probably damaging Het
Nup107 C A 10: 117,774,475 R354L possibly damaging Het
Olfml2a T C 2: 38,941,687 C93R probably damaging Het
Olfr1145 A G 2: 87,810,341 I174V probably benign Het
Olfr1157 A T 2: 87,962,832 V20D probably benign Het
Olfr384 C G 11: 73,602,805 S75C possibly damaging Het
Pappa T A 4: 65,297,257 L1134M probably damaging Het
Plscr4 T G 9: 92,488,630 F217V possibly damaging Het
Pnpla8 T A 12: 44,308,057 Y667N probably benign Het
Polg A G 7: 79,464,928 L95P probably damaging Het
Psg20 T G 7: 18,682,718 I158L probably damaging Het
Pwwp2a A G 11: 43,705,318 S437G probably benign Het
Rdx A G 9: 52,069,732 M305V possibly damaging Het
Rinl A G 7: 28,796,743 E383G probably damaging Het
Ror1 A G 4: 100,442,093 M888V probably benign Het
Rps12 A T 10: 23,786,878 I22K possibly damaging Het
Rtca C A 3: 116,497,674 R219L possibly damaging Het
Ryr2 G A 13: 11,712,195 P2427S probably damaging Het
Slc10a6 A G 5: 103,609,056 Y281H probably benign Het
Slc39a11 A G 11: 113,369,803 S176P probably benign Het
Slfn10-ps A G 11: 83,030,342 noncoding transcript Het
Spef2 T C 15: 9,729,661 T124A possibly damaging Het
Sult2a4 G T 7: 13,915,260 P207Q probably damaging Het
Tas1r3 G A 4: 155,860,470 R765C probably damaging Het
Tcstv1 T C 13: 119,893,746 T117A probably damaging Het
Tha1 A G 11: 117,869,774 V208A probably damaging Het
Tmbim4 T A 10: 120,224,753 I215N probably damaging Het
Tmem202 T A 9: 59,520,200 I122F probably benign Het
Tomm70a T C 16: 57,121,871 S4P unknown Het
Tpcn2 A G 7: 145,273,975 probably benign Het
Trim36 A T 18: 46,212,337 F10I probably benign Het
Usp30 A G 5: 114,111,163 E176G probably damaging Het
Usp8 T G 2: 126,737,575 probably null Het
Vmn1r32 T A 6: 66,553,549 Y81F probably benign Het
Vps36 G T 8: 22,218,289 probably null Het
Wnt3 A G 11: 103,812,648 H319R possibly damaging Het
Zfp319 A T 8: 95,323,763 probably benign Het
Zfp408 T C 2: 91,645,174 E545G probably damaging Het
Zfp799 C T 17: 32,819,498 R598Q possibly damaging Het
Zfp831 T C 2: 174,648,124 V1228A probably benign Het
Zfp938 T C 10: 82,226,042 D248G probably benign Het
Other mutations in Dnah2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Dnah2 APN 11 69492672 missense possibly damaging 0.93
IGL00418:Dnah2 APN 11 69495066 splice site probably benign
IGL00772:Dnah2 APN 11 69451257 missense probably damaging 0.97
IGL00819:Dnah2 APN 11 69473350 critical splice donor site probably null
IGL00827:Dnah2 APN 11 69448457 missense probably damaging 1.00
IGL01060:Dnah2 APN 11 69478092 missense possibly damaging 0.86
IGL01340:Dnah2 APN 11 69493184 missense probably damaging 0.99
IGL01349:Dnah2 APN 11 69475606 missense probably damaging 0.99
IGL01413:Dnah2 APN 11 69432964 missense probably damaging 0.99
IGL01451:Dnah2 APN 11 69474191 splice site probably benign
IGL01480:Dnah2 APN 11 69458371 missense possibly damaging 0.91
IGL01537:Dnah2 APN 11 69516080 missense probably benign 0.17
IGL01592:Dnah2 APN 11 69431087 missense probably benign 0.14
IGL01612:Dnah2 APN 11 69465063 splice site probably benign
IGL01667:Dnah2 APN 11 69544395 missense probably benign
IGL01667:Dnah2 APN 11 69520941 missense probably damaging 0.98
IGL01691:Dnah2 APN 11 69539443 missense probably benign
IGL02019:Dnah2 APN 11 69474285 missense probably damaging 1.00
IGL02039:Dnah2 APN 11 69499212 missense probably damaging 1.00
IGL02076:Dnah2 APN 11 69422559 missense probably damaging 0.99
IGL02085:Dnah2 APN 11 69458185 missense probably benign 0.07
IGL02158:Dnah2 APN 11 69458123 missense probably benign
IGL02381:Dnah2 APN 11 69446292 missense probably benign 0.25
IGL02681:Dnah2 APN 11 69452933 missense probably benign 0.40
IGL02957:Dnah2 APN 11 69448507 missense possibly damaging 0.96
IGL02961:Dnah2 APN 11 69518414 missense probably damaging 1.00
IGL02969:Dnah2 APN 11 69521187 missense possibly damaging 0.80
IGL03117:Dnah2 APN 11 69436291 splice site probably benign
IGL03120:Dnah2 APN 11 69421848 missense probably damaging 1.00
IGL03183:Dnah2 APN 11 69458488 missense possibly damaging 0.94
IGL03197:Dnah2 APN 11 69459263 missense probably damaging 1.00
IGL03263:Dnah2 APN 11 69529381 critical splice donor site probably null
IGL03333:Dnah2 APN 11 69495123 missense probably damaging 1.00
IGL03338:Dnah2 APN 11 69496577 missense probably benign 0.13
argyrios UTSW 11 69516590 missense possibly damaging 0.47
Aureus UTSW 11 69429348 missense probably damaging 1.00
platinum UTSW 11 69458042 missense probably damaging 0.96
R0334_dnah2_144 UTSW 11 69436836 missense probably damaging 1.00
R2150_dnah2_212 UTSW 11 69515761 missense probably benign 0.14
BB005:Dnah2 UTSW 11 69430835 missense probably damaging 0.98
BB015:Dnah2 UTSW 11 69430835 missense probably damaging 0.98
E0370:Dnah2 UTSW 11 69515615 splice site probably null
P0026:Dnah2 UTSW 11 69464947 missense probably damaging 1.00
R0133:Dnah2 UTSW 11 69421009 missense probably damaging 1.00
R0190:Dnah2 UTSW 11 69435249 missense probably damaging 1.00
R0334:Dnah2 UTSW 11 69436836 missense probably damaging 1.00
R0359:Dnah2 UTSW 11 69529531 missense probably benign 0.00
R0386:Dnah2 UTSW 11 69447861 missense probably damaging 1.00
R0414:Dnah2 UTSW 11 69499238 missense probably benign 0.26
R0427:Dnah2 UTSW 11 69452879 missense probably damaging 0.99
R0433:Dnah2 UTSW 11 69459288 missense probably damaging 1.00
R0442:Dnah2 UTSW 11 69448542 missense probably damaging 1.00
R0462:Dnah2 UTSW 11 69459201 missense probably damaging 1.00
R0463:Dnah2 UTSW 11 69423126 missense probably damaging 1.00
R0611:Dnah2 UTSW 11 69499194 missense probably damaging 1.00
R0626:Dnah2 UTSW 11 69477683 missense probably benign 0.07
R0924:Dnah2 UTSW 11 69421308 missense probably damaging 1.00
R0968:Dnah2 UTSW 11 69448519 missense possibly damaging 0.67
R1066:Dnah2 UTSW 11 69447819 missense probably damaging 1.00
R1183:Dnah2 UTSW 11 69446648 missense possibly damaging 0.95
R1184:Dnah2 UTSW 11 69499190 missense probably damaging 1.00
R1186:Dnah2 UTSW 11 69515700 missense probably damaging 0.99
R1453:Dnah2 UTSW 11 69451050 missense probably damaging 0.99
R1498:Dnah2 UTSW 11 69520667 splice site probably null
R1538:Dnah2 UTSW 11 69477202 missense probably benign 0.17
R1574:Dnah2 UTSW 11 69514688 missense probably benign 0.26
R1574:Dnah2 UTSW 11 69514688 missense probably benign 0.26
R1590:Dnah2 UTSW 11 69422754 critical splice donor site probably null
R1590:Dnah2 UTSW 11 69521198 missense probably benign 0.00
R1655:Dnah2 UTSW 11 69473854 missense probably damaging 1.00
R1695:Dnah2 UTSW 11 69514691 missense possibly damaging 0.74
R1726:Dnah2 UTSW 11 69497889 missense probably damaging 1.00
R1764:Dnah2 UTSW 11 69423543 missense probably damaging 1.00
R1815:Dnah2 UTSW 11 69475574 missense probably damaging 1.00
R1822:Dnah2 UTSW 11 69514804 missense probably damaging 1.00
R1859:Dnah2 UTSW 11 69437886 missense probably damaging 0.99
R1911:Dnah2 UTSW 11 69515752 missense possibly damaging 0.64
R1913:Dnah2 UTSW 11 69464930 missense probably damaging 1.00
R1981:Dnah2 UTSW 11 69474325 missense probably damaging 1.00
R2010:Dnah2 UTSW 11 69458358 critical splice donor site probably null
R2016:Dnah2 UTSW 11 69437070 missense probably damaging 0.97
R2017:Dnah2 UTSW 11 69437070 missense probably damaging 0.97
R2044:Dnah2 UTSW 11 69524240 missense probably benign 0.14
R2077:Dnah2 UTSW 11 69496606 missense possibly damaging 0.73
R2096:Dnah2 UTSW 11 69455916 missense probably damaging 0.98
R2099:Dnah2 UTSW 11 69493237 missense probably damaging 1.00
R2128:Dnah2 UTSW 11 69458185 missense probably benign 0.02
R2146:Dnah2 UTSW 11 69515761 missense probably benign 0.14
R2147:Dnah2 UTSW 11 69515761 missense probably benign 0.14
R2150:Dnah2 UTSW 11 69515761 missense probably benign 0.14
R2404:Dnah2 UTSW 11 69437221 missense probably damaging 0.99
R2510:Dnah2 UTSW 11 69524206 nonsense probably null
R2517:Dnah2 UTSW 11 69516644 missense probably damaging 1.00
R3014:Dnah2 UTSW 11 69430478 missense probably benign
R3741:Dnah2 UTSW 11 69448469 missense probably damaging 1.00
R3814:Dnah2 UTSW 11 69492650 splice site probably null
R3872:Dnah2 UTSW 11 69429348 missense probably damaging 1.00
R3873:Dnah2 UTSW 11 69429348 missense probably damaging 1.00
R3874:Dnah2 UTSW 11 69429348 missense probably damaging 1.00
R3875:Dnah2 UTSW 11 69429348 missense probably damaging 1.00
R3881:Dnah2 UTSW 11 69451347 missense possibly damaging 0.94
R3953:Dnah2 UTSW 11 69454103 missense probably damaging 1.00
R3956:Dnah2 UTSW 11 69484021 missense probably benign 0.00
R4501:Dnah2 UTSW 11 69477659 missense probably benign
R4515:Dnah2 UTSW 11 69465631 missense possibly damaging 0.61
R4612:Dnah2 UTSW 11 69483367 missense possibly damaging 0.93
R4625:Dnah2 UTSW 11 69463661 missense probably damaging 1.00
R4627:Dnah2 UTSW 11 69465376 missense probably damaging 1.00
R4642:Dnah2 UTSW 11 69496559 missense probably benign 0.00
R4683:Dnah2 UTSW 11 69458942 missense probably damaging 1.00
R4698:Dnah2 UTSW 11 69498532 missense probably damaging 1.00
R4710:Dnah2 UTSW 11 69478077 missense probably damaging 1.00
R4712:Dnah2 UTSW 11 69516590 missense possibly damaging 0.47
R4713:Dnah2 UTSW 11 69476688 missense probably damaging 1.00
R4717:Dnah2 UTSW 11 69429357 missense probably benign 0.00
R4740:Dnah2 UTSW 11 69458042 missense probably damaging 0.96
R4780:Dnah2 UTSW 11 69473871 missense probably damaging 0.97
R4825:Dnah2 UTSW 11 69423205 missense probably damaging 1.00
R4864:Dnah2 UTSW 11 69422590 missense probably damaging 0.98
R4868:Dnah2 UTSW 11 69463648 missense probably damaging 1.00
R4879:Dnah2 UTSW 11 69476691 missense probably damaging 1.00
R4908:Dnah2 UTSW 11 69521147 missense probably benign 0.00
R4911:Dnah2 UTSW 11 69499104 critical splice donor site probably null
R4954:Dnah2 UTSW 11 69539496 missense possibly damaging 0.61
R4962:Dnah2 UTSW 11 69455973 nonsense probably null
R5015:Dnah2 UTSW 11 69497882 missense possibly damaging 0.89
R5049:Dnah2 UTSW 11 69448166 missense probably damaging 1.00
R5055:Dnah2 UTSW 11 69520773 missense possibly damaging 0.67
R5153:Dnah2 UTSW 11 69520933 missense possibly damaging 0.84
R5155:Dnah2 UTSW 11 69422536 missense probably damaging 1.00
R5186:Dnah2 UTSW 11 69435884 missense probably damaging 1.00
R5187:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5208:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5252:Dnah2 UTSW 11 69529469 missense probably damaging 0.98
R5296:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5298:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5299:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5301:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5324:Dnah2 UTSW 11 69457993 missense probably benign 0.07
R5350:Dnah2 UTSW 11 69516036 missense possibly damaging 0.48
R5377:Dnah2 UTSW 11 69421848 missense probably damaging 1.00
R5393:Dnah2 UTSW 11 69500857 missense probably benign
R5421:Dnah2 UTSW 11 69435636 missense probably damaging 1.00
R5452:Dnah2 UTSW 11 69524383 missense probably damaging 1.00
R5461:Dnah2 UTSW 11 69473351 critical splice donor site probably null
R5474:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5476:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5477:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5510:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5527:Dnah2 UTSW 11 69437188 nonsense probably null
R5566:Dnah2 UTSW 11 69516569 nonsense probably null
R5587:Dnah2 UTSW 11 69437242 missense probably damaging 1.00
R5628:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5688:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5690:Dnah2 UTSW 11 69491544 missense probably benign 0.15
R5711:Dnah2 UTSW 11 69435390 missense probably damaging 1.00
R5735:Dnah2 UTSW 11 69430817 missense possibly damaging 0.93
R5826:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5913:Dnah2 UTSW 11 69448430 missense probably damaging 1.00
R5914:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5960:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5961:Dnah2 UTSW 11 69431148 missense probably damaging 1.00
R5961:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5977:Dnah2 UTSW 11 69520881 missense possibly damaging 0.79
R6020:Dnah2 UTSW 11 69500839 missense probably benign
R6036:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R6036:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R6050:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R6086:Dnah2 UTSW 11 69516008 missense probably benign 0.30
R6115:Dnah2 UTSW 11 69446649 missense probably damaging 1.00
R6123:Dnah2 UTSW 11 69518359 missense probably benign 0.29
R6159:Dnah2 UTSW 11 69458542 missense probably damaging 1.00
R6159:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R6163:Dnah2 UTSW 11 69520903 nonsense probably null
R6171:Dnah2 UTSW 11 69423042 missense probably damaging 1.00
R6263:Dnah2 UTSW 11 69457412 missense probably damaging 1.00
R6298:Dnah2 UTSW 11 69491641 missense probably benign 0.25
R6352:Dnah2 UTSW 11 69448227 missense probably damaging 1.00
R6399:Dnah2 UTSW 11 69458518 missense probably damaging 0.98
R6466:Dnah2 UTSW 11 69539415 missense probably benign
R6478:Dnah2 UTSW 11 69516010 missense probably benign 0.01
R6516:Dnah2 UTSW 11 69465386 missense probably benign 0.34
R6538:Dnah2 UTSW 11 69437197 missense possibly damaging 0.87
R6802:Dnah2 UTSW 11 69423690 missense probably damaging 1.00
R6861:Dnah2 UTSW 11 69455963 missense possibly damaging 0.64
R6869:Dnah2 UTSW 11 69429471 missense probably damaging 1.00
R6894:Dnah2 UTSW 11 69484260 missense probably benign 0.12
R6935:Dnah2 UTSW 11 69421741 missense probably damaging 1.00
R7017:Dnah2 UTSW 11 69491547 nonsense probably null
R7073:Dnah2 UTSW 11 69430492 nonsense probably null
R7111:Dnah2 UTSW 11 69446753 splice site probably null
R7125:Dnah2 UTSW 11 69436182 missense probably damaging 0.99
R7137:Dnah2 UTSW 11 69491555 missense probably damaging 1.00
R7190:Dnah2 UTSW 11 69549097 splice site probably null
R7214:Dnah2 UTSW 11 69431109 missense probably damaging 1.00
R7227:Dnah2 UTSW 11 69421396 missense probably damaging 0.99
R7238:Dnah2 UTSW 11 69459146 critical splice donor site probably null
R7256:Dnah2 UTSW 11 69431094 missense probably damaging 1.00
R7267:Dnah2 UTSW 11 69500817 missense probably damaging 1.00
R7420:Dnah2 UTSW 11 69478797 missense possibly damaging 0.94
R7421:Dnah2 UTSW 11 69492805 missense probably benign 0.25
R7437:Dnah2 UTSW 11 69498627 missense probably damaging 1.00
R7461:Dnah2 UTSW 11 69548990 critical splice donor site probably null
R7473:Dnah2 UTSW 11 69491658 missense probably damaging 0.99
R7528:Dnah2 UTSW 11 69500796 missense probably damaging 0.99
R7613:Dnah2 UTSW 11 69548990 critical splice donor site probably null
R7615:Dnah2 UTSW 11 69435304 missense probably damaging 0.99
R7626:Dnah2 UTSW 11 69498685 missense probably damaging 0.99
R7745:Dnah2 UTSW 11 69451318 nonsense probably null
R7764:Dnah2 UTSW 11 69458158 missense probably benign 0.29
R7793:Dnah2 UTSW 11 69495214 missense probably benign 0.00
R7819:Dnah2 UTSW 11 69516593 missense probably benign 0.01
R7881:Dnah2 UTSW 11 69431238 missense probably damaging 1.00
R7900:Dnah2 UTSW 11 69518428 missense probably damaging 1.00
R7916:Dnah2 UTSW 11 69421148 critical splice acceptor site probably null
R7921:Dnah2 UTSW 11 69520834 missense probably benign
R7928:Dnah2 UTSW 11 69430835 missense probably damaging 0.98
R7937:Dnah2 UTSW 11 69517685 nonsense probably null
R7995:Dnah2 UTSW 11 69520737 missense possibly damaging 0.77
R8202:Dnah2 UTSW 11 69478823 missense probably benign 0.00
R8208:Dnah2 UTSW 11 69520852 missense probably benign 0.05
R8215:Dnah2 UTSW 11 69435367 missense probably damaging 1.00
R8279:Dnah2 UTSW 11 69475573 missense probably damaging 1.00
R8338:Dnah2 UTSW 11 69487296 missense probably damaging 1.00
R8348:Dnah2 UTSW 11 69429447 missense possibly damaging 0.95
R8405:Dnah2 UTSW 11 69458463 missense probably damaging 1.00
R8407:Dnah2 UTSW 11 69459278 missense probably benign 0.00
R8493:Dnah2 UTSW 11 69452978 missense probably damaging 1.00
R8673:Dnah2 UTSW 11 69514697 missense probably benign 0.23
R8725:Dnah2 UTSW 11 69524179 missense probably damaging 1.00
R8727:Dnah2 UTSW 11 69524179 missense probably damaging 1.00
R8730:Dnah2 UTSW 11 69493261 missense possibly damaging 0.73
R8804:Dnah2 UTSW 11 69465685 missense probably benign 0.01
R8876:Dnah2 UTSW 11 69491522 missense probably damaging 1.00
R8894:Dnah2 UTSW 11 69492222 missense probably benign 0.01
R8938:Dnah2 UTSW 11 69437928 missense probably damaging 0.99
RF004:Dnah2 UTSW 11 69437187 missense probably benign 0.24
U24488:Dnah2 UTSW 11 69483822 missense probably damaging 0.99
X0021:Dnah2 UTSW 11 69448562 missense possibly damaging 0.81
Z1088:Dnah2 UTSW 11 69430793 missense probably damaging 1.00
Z1176:Dnah2 UTSW 11 69421821 missense possibly damaging 0.46
Z1176:Dnah2 UTSW 11 69451120 missense probably benign
Z1176:Dnah2 UTSW 11 69487054 missense possibly damaging 0.46
Z1176:Dnah2 UTSW 11 69498667 missense probably benign 0.12
Z1176:Dnah2 UTSW 11 69516481 missense probably damaging 1.00
Z1176:Dnah2 UTSW 11 69516523 missense probably damaging 1.00
Z1177:Dnah2 UTSW 11 69463453 missense possibly damaging 0.63
Z1177:Dnah2 UTSW 11 69544557 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AGGATGCTTACTCGGATGTGC -3'
(R):5'- CAACATGTCCGCACAGGTAC -3'

Sequencing Primer
(F):5'- GATGCTCTGCTTCACACGATCG -3'
(R):5'- ATGTCCGCACAGGTACGTGAG -3'
Posted On2014-09-17