Mutagenetix > Incidental Mutation

Incidental Mutation 'R2127:Abca6'

227651

Institutional Source

Beutler Lab

Gene Symbol

Abca6

Ensembl Gene

ENSMUSG00000044749

Gene Name

ATP-binding cassette, sub-family A (ABC1), member 6

Synonyms

6330565N06Rik

MMRRC Submission

040130-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2127 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

110176820-110251776 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 110219649 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 558 (I558T)

Ref Sequence

ENSEMBL: ENSMUSP00000035458 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044003]

AlphaFold

Q8K441

Predicted Effect

probably benign
Transcript: ENSMUST00000044003
AA Change: I558T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000035458
Gene: ENSMUSG00000044749
AA Change: I558T

Domain	Start	End	E-Value	Type
Pfam:ABC2_membrane_3	28	416	1.4e-42	PFAM
low complexity region	484	495	N/A	INTRINSIC
AAA	506	691	1.13e-6	SMART
transmembrane domain	854	876	N/A	INTRINSIC
transmembrane domain	971	990	N/A	INTRINSIC
transmembrane domain	1005	1027	N/A	INTRINSIC
Blast:AAA	1041	1176	4e-21	BLAST
transmembrane domain	1191	1213	N/A	INTRINSIC
low complexity region	1243	1254	N/A	INTRINSIC
AAA	1312	1505	2.43e-6	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

98% (93/95)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White). This encoded protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This gene is clustered among 4 other ABC1 family members on 17q24 and may play a role in macrophage lipid homeostasis. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930449I24Rik	T	A	5: 146,504,942	S300T	possibly damaging	Het
4932431P20Rik	T	C	7: 29,537,140		noncoding transcript	Het
A2ml1	A	C	6: 128,558,437	V770G	probably damaging	Het
Abhd17c	C	A	7: 84,110,662	G295W	probably damaging	Het
Actn3	G	A	19: 4,871,675	A159V	probably damaging	Het
Adgrv1	A	T	13: 81,557,080	F1537Y	probably damaging	Het
Agbl1	G	T	7: 76,419,880	V373F	possibly damaging	Het
Aldh1a1	A	T	19: 20,642,915	E485D	probably benign	Het
Amdhd2	A	G	17: 24,158,308		probably null	Het
Armc3	A	G	2: 19,201,811	D15G	probably damaging	Het
Atp2b2	A	G	6: 113,760,650	L921P	probably damaging	Het
Btbd16	A	G	7: 130,784,308	N88S	probably benign	Het
Capn10	T	A	1: 92,938,034	C77*	probably null	Het
Caskin1	T	C	17: 24,496,996		probably null	Het
Catsper4	T	C	4: 134,213,806	D254G	probably benign	Het
Catsperg1	T	C	7: 29,185,040	D958G	probably damaging	Het
Ccar2	T	G	14: 70,139,651	K787Q	probably benign	Het
Ccdc191	C	T	16: 43,908,635	T244I	probably benign	Het
Cd33	A	T	7: 43,530,275	L243Q	possibly damaging	Het
Cdc37	T	C	9: 21,149,847	Y4C	probably damaging	Het
Cenpe	T	G	3: 135,239,780	N1018K	probably benign	Het
Crocc	G	A	4: 141,017,096	R1830C	probably damaging	Het
Csmd1	T	C	8: 15,917,392	D3157G	probably damaging	Het
Dhx57	C	T	17: 80,273,048	V492M	probably damaging	Het
Dnah2	A	T	11: 69,458,185	I2486N	probably benign	Het
Dnhd1	C	T	7: 105,693,721	T1424I	possibly damaging	Het
Dsc3	C	T	18: 19,968,354	A661T	probably benign	Het
F930015N05Rik	A	G	11: 64,435,403		probably benign	Het
Fbxo34	C	A	14: 47,530,106	R308S	probably damaging	Het
Gm10608	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	9: 119,160,716		probably benign	Het
Gm11595	A	T	11: 99,772,501	C118S	unknown	Het
Gm9742	A	T	13: 8,034,975		noncoding transcript	Het
Gmeb2	G	A	2: 181,259,049	A185V	probably benign	Het
Gpr15	A	G	16: 58,718,255	V157A	possibly damaging	Het
Gpr3	C	T	4: 133,210,621	A247T	probably damaging	Het
Grin2b	A	C	6: 135,778,700	S539A	probably benign	Het
Hmbs	T	C	9: 44,340,707	T92A	probably benign	Het
Inpp4a	A	G	1: 37,366,919	M173V	probably benign	Het
Irx4	T	A	13: 73,265,476	S22T	probably benign	Het
Jph3	C	T	8: 121,785,142	A623V	probably benign	Het
Kif1b	G	A	4: 149,187,640	S1568L	possibly damaging	Het
Ksr1	G	A	11: 79,033,313	S361L	probably damaging	Het
Lyst	T	G	13: 13,635,262	Y506D	probably damaging	Het
Mctp1	A	G	13: 76,824,822	D648G	probably damaging	Het
Megf8	T	C	7: 25,364,582	S2788P	possibly damaging	Het
Mfsd2b	T	A	12: 4,867,659	Y129F	probably benign	Het
Mindy4	T	C	6: 55,218,265	S155P	probably benign	Het
Mospd4	A	G	18: 46,465,664		noncoding transcript	Het
Myo18b	A	T	5: 112,831,078	L1223Q	probably damaging	Het
Nckipsd	A	G	9: 108,811,733	T156A	probably benign	Het
Ndst1	G	A	18: 60,691,208	T799I	probably benign	Het
Npffr2	A	T	5: 89,568,065	I84F	probably damaging	Het
Nphp3	G	A	9: 104,008,243	V167M	probably damaging	Het
Nup107	C	A	10: 117,774,475	R354L	possibly damaging	Het
Olfml2a	T	C	2: 38,941,687	C93R	probably damaging	Het
Olfr1145	A	G	2: 87,810,341	I174V	probably benign	Het
Olfr1157	A	T	2: 87,962,832	V20D	probably benign	Het
Olfr384	C	G	11: 73,602,805	S75C	possibly damaging	Het
Pappa	T	A	4: 65,297,257	L1134M	probably damaging	Het
Plscr4	T	G	9: 92,488,630	F217V	possibly damaging	Het
Pnpla8	T	A	12: 44,308,057	Y667N	probably benign	Het
Polg	A	G	7: 79,464,928	L95P	probably damaging	Het
Psg20	T	G	7: 18,682,718	I158L	probably damaging	Het
Pwwp2a	A	G	11: 43,705,318	S437G	probably benign	Het
Rdx	A	G	9: 52,069,732	M305V	possibly damaging	Het
Rinl	A	G	7: 28,796,743	E383G	probably damaging	Het
Ror1	A	G	4: 100,442,093	M888V	probably benign	Het
Rps12	A	T	10: 23,786,878	I22K	possibly damaging	Het
Rtca	C	A	3: 116,497,674	R219L	possibly damaging	Het
Ryr2	G	A	13: 11,712,195	P2427S	probably damaging	Het
Slc10a6	A	G	5: 103,609,056	Y281H	probably benign	Het
Slc39a11	A	G	11: 113,369,803	S176P	probably benign	Het
Slfn10-ps	A	G	11: 83,030,342		noncoding transcript	Het
Spef2	T	C	15: 9,729,661	T124A	possibly damaging	Het
Sult2a4	G	T	7: 13,915,260	P207Q	probably damaging	Het
Tas1r3	G	A	4: 155,860,470	R765C	probably damaging	Het
Tcstv1	T	C	13: 119,893,746	T117A	probably damaging	Het
Tha1	A	G	11: 117,869,774	V208A	probably damaging	Het
Tmbim4	T	A	10: 120,224,753	I215N	probably damaging	Het
Tmem202	T	A	9: 59,520,200	I122F	probably benign	Het
Tomm70a	T	C	16: 57,121,871	S4P	unknown	Het
Tpcn2	A	G	7: 145,273,975		probably benign	Het
Trim36	A	T	18: 46,212,337	F10I	probably benign	Het
Usp30	A	G	5: 114,111,163	E176G	probably damaging	Het
Usp8	T	G	2: 126,737,575		probably null	Het
Vmn1r32	T	A	6: 66,553,549	Y81F	probably benign	Het
Vps36	G	T	8: 22,218,289		probably null	Het
Wnt3	A	G	11: 103,812,648	H319R	possibly damaging	Het
Zfp319	A	T	8: 95,323,763		probably benign	Het
Zfp408	T	C	2: 91,645,174	E545G	probably damaging	Het
Zfp799	C	T	17: 32,819,498	R598Q	possibly damaging	Het
Zfp831	T	C	2: 174,648,124	V1228A	probably benign	Het
Zfp938	T	C	10: 82,226,042	D248G	probably benign	Het

Other mutations in Abca6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:Abca6	APN	11	110184709	missense	probably damaging	1.00
IGL00569:Abca6	APN	11	110187049	missense	possibly damaging	0.88
IGL00737:Abca6	APN	11	110196997	splice site	probably benign
IGL01024:Abca6	APN	11	110197142	missense	probably benign
IGL01087:Abca6	APN	11	110191650	missense	probably benign	0.00
IGL01511:Abca6	APN	11	110244310	missense	probably benign	0.00
IGL01516:Abca6	APN	11	110218217	missense	possibly damaging	0.70
IGL01621:Abca6	APN	11	110184708	missense	probably damaging	1.00
IGL01749:Abca6	APN	11	110244224	missense	probably damaging	1.00
IGL01934:Abca6	APN	11	110188655	missense	probably benign	0.00
IGL02010:Abca6	APN	11	110219616	missense	probably benign	0.12
IGL02121:Abca6	APN	11	110182924	missense	probably benign	0.38
IGL02423:Abca6	APN	11	110219006	splice site	probably benign
IGL02428:Abca6	APN	11	110178792	missense	possibly damaging	0.81
IGL02491:Abca6	APN	11	110176968	utr 3 prime	probably benign
IGL02541:Abca6	APN	11	110212267	missense	probably damaging	1.00
IGL02792:Abca6	APN	11	110188681	missense	probably damaging	0.99
IGL02836:Abca6	APN	11	110248548	missense	probably damaging	1.00
IGL02965:Abca6	APN	11	110180613	missense	probably benign
IGL03094:Abca6	APN	11	110184112	missense	probably benign	0.03
IGL03109:Abca6	APN	11	110180347	missense	probably damaging	0.96
R0068:Abca6	UTSW	11	110182882	missense	probably damaging	1.00
R0142:Abca6	UTSW	11	110188641	missense	probably damaging	1.00
R0165:Abca6	UTSW	11	110219604	missense	possibly damaging	0.90
R0254:Abca6	UTSW	11	110236789	missense	probably benign	0.16
R0598:Abca6	UTSW	11	110197154	missense	probably damaging	1.00
R0992:Abca6	UTSW	11	110211684	missense	probably damaging	1.00
R1386:Abca6	UTSW	11	110244255	missense	probably benign	0.02
R1642:Abca6	UTSW	11	110218281	missense	possibly damaging	0.73
R1673:Abca6	UTSW	11	110212339	missense	probably benign	0.01
R1792:Abca6	UTSW	11	110184044	missense	probably benign	0.00
R1813:Abca6	UTSW	11	110233845	splice site	probably benign
R1817:Abca6	UTSW	11	110219318	missense	probably benign	0.00
R1842:Abca6	UTSW	11	110197039	missense	probably benign	0.00
R1898:Abca6	UTSW	11	110208799	missense	probably damaging	0.99
R1914:Abca6	UTSW	11	110212210	missense	probably benign	0.06
R1915:Abca6	UTSW	11	110212210	missense	probably benign	0.06
R1934:Abca6	UTSW	11	110210083	critical splice donor site	probably null
R1964:Abca6	UTSW	11	110184676	missense	probably damaging	0.98
R1967:Abca6	UTSW	11	110187148	missense	probably benign	0.09
R2128:Abca6	UTSW	11	110219649	missense	probably benign	0.00
R2164:Abca6	UTSW	11	110210193	frame shift	probably null
R2895:Abca6	UTSW	11	110202426	missense	probably benign	0.00
R3110:Abca6	UTSW	11	110178829	nonsense	probably null
R3111:Abca6	UTSW	11	110178829	nonsense	probably null
R3112:Abca6	UTSW	11	110178829	nonsense	probably null
R4094:Abca6	UTSW	11	110180366	missense	probably damaging	1.00
R4432:Abca6	UTSW	11	110241588	missense	probably benign	0.11
R4474:Abca6	UTSW	11	110233772	missense	possibly damaging	0.46
R4572:Abca6	UTSW	11	110216548	missense	probably benign	0.31
R4629:Abca6	UTSW	11	110230549	critical splice acceptor site	probably null
R4793:Abca6	UTSW	11	110191718	missense	probably benign
R4852:Abca6	UTSW	11	110244203	missense	probably benign	0.09
R4867:Abca6	UTSW	11	110202379	missense	probably benign	0.01
R4879:Abca6	UTSW	11	110219700	missense	probably damaging	0.98
R4918:Abca6	UTSW	11	110180551	missense	probably damaging	1.00
R5060:Abca6	UTSW	11	110219604	missense	possibly damaging	0.90
R5062:Abca6	UTSW	11	110177066	missense	probably benign	0.12
R5083:Abca6	UTSW	11	110218967	missense	probably damaging	1.00
R5173:Abca6	UTSW	11	110191720	missense	probably benign
R5393:Abca6	UTSW	11	110244295	missense	probably benign	0.00
R5484:Abca6	UTSW	11	110184073	missense	probably damaging	1.00
R5498:Abca6	UTSW	11	110208844	missense	possibly damaging	0.95
R5503:Abca6	UTSW	11	110218257	missense	probably damaging	1.00
R5645:Abca6	UTSW	11	110250408	missense	probably damaging	0.99
R5680:Abca6	UTSW	11	110236645	missense	possibly damaging	0.88
R5761:Abca6	UTSW	11	110210101	missense	probably damaging	1.00
R5779:Abca6	UTSW	11	110184670	missense	probably benign	0.37
R5818:Abca6	UTSW	11	110219643	missense	probably damaging	1.00
R6282:Abca6	UTSW	11	110208824	missense	probably damaging	0.98
R6455:Abca6	UTSW	11	110241581	missense	probably damaging	1.00
R6826:Abca6	UTSW	11	110216605	missense	probably benign	0.15
R6857:Abca6	UTSW	11	110219688	missense	possibly damaging	0.63
R6914:Abca6	UTSW	11	110190238	missense	probably benign
R6931:Abca6	UTSW	11	110244328	missense	probably benign	0.27
R7222:Abca6	UTSW	11	110191693	missense	probably benign	0.29
R7242:Abca6	UTSW	11	110241653	missense	possibly damaging	0.47
R7297:Abca6	UTSW	11	110183026	critical splice donor site	probably null
R7387:Abca6	UTSW	11	110202420	missense	probably benign
R7420:Abca6	UTSW	11	110250477	missense	probably benign	0.24
R7494:Abca6	UTSW	11	110208745	missense	possibly damaging	0.93
R7603:Abca6	UTSW	11	110180258	missense	possibly damaging	0.69
R7637:Abca6	UTSW	11	110218952	missense	probably benign	0.00
R7674:Abca6	UTSW	11	110219297	missense	probably damaging	1.00
R7753:Abca6	UTSW	11	110184107	missense	probably damaging	1.00
R7800:Abca6	UTSW	11	110187872	missense	probably benign	0.00
R7842:Abca6	UTSW	11	110196697	missense	possibly damaging	0.76
R7855:Abca6	UTSW	11	110191628	missense	probably benign	0.01
R8119:Abca6	UTSW	11	110197104	missense	probably benign	0.00
R8139:Abca6	UTSW	11	110184133	missense	probably damaging	1.00
R8176:Abca6	UTSW	11	110244194	missense	probably benign	0.01
R8179:Abca6	UTSW	11	110245274	missense	probably damaging	1.00
R8197:Abca6	UTSW	11	110211815	missense	probably damaging	0.99
R8241:Abca6	UTSW	11	110188630	missense	probably null	1.00
R8404:Abca6	UTSW	11	110219319	missense	probably damaging	0.99
R8429:Abca6	UTSW	11	110202382	missense	probably benign
R8502:Abca6	UTSW	11	110219319	missense	probably damaging	0.99
R8816:Abca6	UTSW	11	110236687	missense	probably benign	0.04
R8964:Abca6	UTSW	11	110248537	missense	probably benign	0.00
R9153:Abca6	UTSW	11	110216655	missense	possibly damaging	0.61
R9233:Abca6	UTSW	11	110191670	missense	probably benign	0.31
R9407:Abca6	UTSW	11	110202384	nonsense	probably null
R9412:Abca6	UTSW	11	110212233	missense	probably damaging	0.99
R9453:Abca6	UTSW	11	110247264	critical splice donor site	probably null
R9533:Abca6	UTSW	11	110211756	missense	probably benign	0.16
R9546:Abca6	UTSW	11	110244216	nonsense	probably null
R9650:Abca6	UTSW	11	110180620	missense	probably benign	0.32
R9702:Abca6	UTSW	11	110216552	missense	probably damaging	1.00
R9709:Abca6	UTSW	11	110211763	missense	probably benign	0.01
X0024:Abca6	UTSW	11	110244255	missense	probably benign	0.02
X0064:Abca6	UTSW	11	110197142	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- CTGAGGTCATGATTGAACATGG -3'
(R):5'- ACGTGCTACACAGTATCTACAC -3'

Sequencing Primer
(F):5'- CATGATTGAACATGGTTAATGATGGG -3'
(R):5'- TCCTTGCTAACCTTGAACTA -3'

Posted On

2014-09-17