Incidental Mutation 'R2127:Spef2'
ID227667
Institutional Source Beutler Lab
Gene Symbol Spef2
Ensembl Gene ENSMUSG00000072663
Gene Namesperm flagellar 2
SynonymsC230086A09Rik
MMRRC Submission 040130-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R2127 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location9578193-9748868 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 9729661 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 124 (T124A)
Ref Sequence ENSEMBL: ENSMUSP00000146967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041840] [ENSMUST00000159093] [ENSMUST00000159368] [ENSMUST00000160236] [ENSMUST00000162780] [ENSMUST00000208854]
Predicted Effect probably benign
Transcript: ENSMUST00000041840
AA Change: T124A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000035762
Gene: ENSMUSG00000072663
AA Change: T124A

DomainStartEndE-ValueType
Pfam:DUF1042 5 161 2.8e-59 PFAM
coiled coil region 171 203 N/A INTRINSIC
low complexity region 247 256 N/A INTRINSIC
coiled coil region 312 345 N/A INTRINSIC
Pfam:ADK 600 829 5.9e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159093
AA Change: T124A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000124891
Gene: ENSMUSG00000072663
AA Change: T124A

DomainStartEndE-ValueType
Pfam:DUF1042 5 166 3.5e-57 PFAM
coiled coil region 167 205 N/A INTRINSIC
low complexity region 208 220 N/A INTRINSIC
coiled coil region 228 260 N/A INTRINSIC
low complexity region 304 313 N/A INTRINSIC
coiled coil region 369 402 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159288
AA Change: T124A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000125336
Gene: ENSMUSG00000072663
AA Change: T124A

DomainStartEndE-ValueType
Pfam:CH_2 5 102 3.1e-25 PFAM
low complexity region 106 115 N/A INTRINSIC
low complexity region 137 148 N/A INTRINSIC
low complexity region 151 163 N/A INTRINSIC
coiled coil region 171 203 N/A INTRINSIC
low complexity region 247 256 N/A INTRINSIC
coiled coil region 312 345 N/A INTRINSIC
Pfam:ADK 602 789 8.8e-11 PFAM
low complexity region 819 855 N/A INTRINSIC
low complexity region 899 907 N/A INTRINSIC
low complexity region 1201 1221 N/A INTRINSIC
low complexity region 1264 1278 N/A INTRINSIC
low complexity region 1359 1369 N/A INTRINSIC
SCOP:d1rec__ 1378 1530 3e-3 SMART
low complexity region 1605 1624 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159368
AA Change: T124A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000124723
Gene: ENSMUSG00000072663
AA Change: T124A

DomainStartEndE-ValueType
Pfam:DUF1042 5 162 1.4e-59 PFAM
coiled coil region 171 203 N/A INTRINSIC
low complexity region 247 256 N/A INTRINSIC
coiled coil region 312 345 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160236
AA Change: T124A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000124222
Gene: ENSMUSG00000072663
AA Change: T124A

DomainStartEndE-ValueType
Pfam:DUF1042 5 160 4.6e-59 PFAM
coiled coil region 171 203 N/A INTRINSIC
low complexity region 247 256 N/A INTRINSIC
coiled coil region 312 345 N/A INTRINSIC
Pfam:ADK 600 787 3.7e-10 PFAM
low complexity region 819 855 N/A INTRINSIC
low complexity region 899 907 N/A INTRINSIC
low complexity region 1201 1225 N/A INTRINSIC
low complexity region 1254 1268 N/A INTRINSIC
low complexity region 1349 1359 N/A INTRINSIC
SCOP:d1rec__ 1368 1520 3e-3 SMART
low complexity region 1595 1614 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162780
AA Change: T124A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000124393
Gene: ENSMUSG00000072663
AA Change: T124A

DomainStartEndE-ValueType
Pfam:DUF1042 5 164 1.1e-57 PFAM
coiled coil region 167 205 N/A INTRINSIC
low complexity region 208 220 N/A INTRINSIC
coiled coil region 228 260 N/A INTRINSIC
low complexity region 304 313 N/A INTRINSIC
coiled coil region 369 402 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000208854
AA Change: T124A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
Meta Mutation Damage Score 0.0980 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (93/95)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit male infertility due to oligospermia and abnormal spermatogenesis, hydroencephaly, sinusitis, and background-dependent lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449I24Rik T A 5: 146,504,942 S300T possibly damaging Het
4932431P20Rik T C 7: 29,537,140 noncoding transcript Het
A2ml1 A C 6: 128,558,437 V770G probably damaging Het
Abca6 A G 11: 110,219,649 I558T probably benign Het
Abhd17c C A 7: 84,110,662 G295W probably damaging Het
Actn3 G A 19: 4,871,675 A159V probably damaging Het
Adgrv1 A T 13: 81,557,080 F1537Y probably damaging Het
Agbl1 G T 7: 76,419,880 V373F possibly damaging Het
Aldh1a1 A T 19: 20,642,915 E485D probably benign Het
Amdhd2 A G 17: 24,158,308 probably null Het
Armc3 A G 2: 19,201,811 D15G probably damaging Het
Atp2b2 A G 6: 113,760,650 L921P probably damaging Het
Btbd16 A G 7: 130,784,308 N88S probably benign Het
Capn10 T A 1: 92,938,034 C77* probably null Het
Caskin1 T C 17: 24,496,996 probably null Het
Catsper4 T C 4: 134,213,806 D254G probably benign Het
Catsperg1 T C 7: 29,185,040 D958G probably damaging Het
Ccar2 T G 14: 70,139,651 K787Q probably benign Het
Ccdc191 C T 16: 43,908,635 T244I probably benign Het
Cd33 A T 7: 43,530,275 L243Q possibly damaging Het
Cdc37 T C 9: 21,149,847 Y4C probably damaging Het
Cenpe T G 3: 135,239,780 N1018K probably benign Het
Crocc G A 4: 141,017,096 R1830C probably damaging Het
Csmd1 T C 8: 15,917,392 D3157G probably damaging Het
Dhx57 C T 17: 80,273,048 V492M probably damaging Het
Dnah2 A T 11: 69,458,185 I2486N probably benign Het
Dnhd1 C T 7: 105,693,721 T1424I possibly damaging Het
Dsc3 C T 18: 19,968,354 A661T probably benign Het
F930015N05Rik A G 11: 64,435,403 probably benign Het
Fbxo34 C A 14: 47,530,106 R308S probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Gm11595 A T 11: 99,772,501 C118S unknown Het
Gm9742 A T 13: 8,034,975 noncoding transcript Het
Gmeb2 G A 2: 181,259,049 A185V probably benign Het
Gpr15 A G 16: 58,718,255 V157A possibly damaging Het
Gpr3 C T 4: 133,210,621 A247T probably damaging Het
Grin2b A C 6: 135,778,700 S539A probably benign Het
Hmbs T C 9: 44,340,707 T92A probably benign Het
Inpp4a A G 1: 37,366,919 M173V probably benign Het
Irx4 T A 13: 73,265,476 S22T probably benign Het
Jph3 C T 8: 121,785,142 A623V probably benign Het
Kif1b G A 4: 149,187,640 S1568L possibly damaging Het
Ksr1 G A 11: 79,033,313 S361L probably damaging Het
Lyst T G 13: 13,635,262 Y506D probably damaging Het
Mctp1 A G 13: 76,824,822 D648G probably damaging Het
Megf8 T C 7: 25,364,582 S2788P possibly damaging Het
Mfsd2b T A 12: 4,867,659 Y129F probably benign Het
Mindy4 T C 6: 55,218,265 S155P probably benign Het
Mospd4 A G 18: 46,465,664 noncoding transcript Het
Myo18b A T 5: 112,831,078 L1223Q probably damaging Het
Nckipsd A G 9: 108,811,733 T156A probably benign Het
Ndst1 G A 18: 60,691,208 T799I probably benign Het
Npffr2 A T 5: 89,568,065 I84F probably damaging Het
Nphp3 G A 9: 104,008,243 V167M probably damaging Het
Nup107 C A 10: 117,774,475 R354L possibly damaging Het
Olfml2a T C 2: 38,941,687 C93R probably damaging Het
Olfr1145 A G 2: 87,810,341 I174V probably benign Het
Olfr1157 A T 2: 87,962,832 V20D probably benign Het
Olfr384 C G 11: 73,602,805 S75C possibly damaging Het
Pappa T A 4: 65,297,257 L1134M probably damaging Het
Plscr4 T G 9: 92,488,630 F217V possibly damaging Het
Pnpla8 T A 12: 44,308,057 Y667N probably benign Het
Polg A G 7: 79,464,928 L95P probably damaging Het
Psg20 T G 7: 18,682,718 I158L probably damaging Het
Pwwp2a A G 11: 43,705,318 S437G probably benign Het
Rdx A G 9: 52,069,732 M305V possibly damaging Het
Rinl A G 7: 28,796,743 E383G probably damaging Het
Ror1 A G 4: 100,442,093 M888V probably benign Het
Rps12 A T 10: 23,786,878 I22K possibly damaging Het
Rtca C A 3: 116,497,674 R219L possibly damaging Het
Ryr2 G A 13: 11,712,195 P2427S probably damaging Het
Slc10a6 A G 5: 103,609,056 Y281H probably benign Het
Slc39a11 A G 11: 113,369,803 S176P probably benign Het
Slfn10-ps A G 11: 83,030,342 noncoding transcript Het
Sult2a4 G T 7: 13,915,260 P207Q probably damaging Het
Tas1r3 G A 4: 155,860,470 R765C probably damaging Het
Tcstv1 T C 13: 119,893,746 T117A probably damaging Het
Tha1 A G 11: 117,869,774 V208A probably damaging Het
Tmbim4 T A 10: 120,224,753 I215N probably damaging Het
Tmem202 T A 9: 59,520,200 I122F probably benign Het
Tomm70a T C 16: 57,121,871 S4P unknown Het
Tpcn2 A G 7: 145,273,975 probably benign Het
Trim36 A T 18: 46,212,337 F10I probably benign Het
Usp30 A G 5: 114,111,163 E176G probably damaging Het
Usp8 T G 2: 126,737,575 probably null Het
Vmn1r32 T A 6: 66,553,549 Y81F probably benign Het
Vps36 G T 8: 22,218,289 probably null Het
Wnt3 A G 11: 103,812,648 H319R possibly damaging Het
Zfp319 A T 8: 95,323,763 probably benign Het
Zfp408 T C 2: 91,645,174 E545G probably damaging Het
Zfp799 C T 17: 32,819,498 R598Q possibly damaging Het
Zfp831 T C 2: 174,648,124 V1228A probably benign Het
Zfp938 T C 10: 82,226,042 D248G probably benign Het
Other mutations in Spef2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Spef2 APN 15 9740535 missense probably damaging 1.00
IGL00886:Spef2 APN 15 9663095 missense probably damaging 1.00
IGL01409:Spef2 APN 15 9716413 missense probably damaging 1.00
IGL01413:Spef2 APN 15 9676290 missense probably benign 0.16
IGL01474:Spef2 APN 15 9663158 missense probably benign 0.00
IGL01603:Spef2 APN 15 9704380 missense probably damaging 0.99
IGL02320:Spef2 APN 15 9717576 missense probably damaging 0.99
IGL02570:Spef2 APN 15 9717498 nonsense probably null
IGL02605:Spef2 APN 15 9725152 missense probably damaging 0.99
IGL02890:Spef2 APN 15 9748767 start codon destroyed probably null 1.00
IGL02904:Spef2 APN 15 9679346 missense probably damaging 1.00
IGL02942:Spef2 APN 15 9668874 missense possibly damaging 0.71
IGL02953:Spef2 APN 15 9713243 missense possibly damaging 0.82
IGL02965:Spef2 APN 15 9725106 splice site probably benign
IGL03263:Spef2 APN 15 9667219 missense possibly damaging 0.72
IGL03302:Spef2 APN 15 9676380 missense probably benign 0.01
R0101:Spef2 UTSW 15 9713108 missense probably damaging 1.00
R0101:Spef2 UTSW 15 9713108 missense probably damaging 1.00
R0183:Spef2 UTSW 15 9716359 missense possibly damaging 0.70
R0386:Spef2 UTSW 15 9584062 missense probably damaging 1.00
R0511:Spef2 UTSW 15 9583984 critical splice donor site probably null
R0617:Spef2 UTSW 15 9592758 missense probably damaging 1.00
R0655:Spef2 UTSW 15 9626131 missense possibly damaging 0.96
R0829:Spef2 UTSW 15 9687813 missense probably benign 0.10
R0908:Spef2 UTSW 15 9614195 splice site probably null
R0939:Spef2 UTSW 15 9704550 splice site probably null
R0973:Spef2 UTSW 15 9716396 missense probably damaging 1.00
R1371:Spef2 UTSW 15 9725108 splice site probably benign
R1392:Spef2 UTSW 15 9647263 missense probably benign 0.15
R1392:Spef2 UTSW 15 9647263 missense probably benign 0.15
R1428:Spef2 UTSW 15 9596707 unclassified probably benign
R1518:Spef2 UTSW 15 9667230 missense probably damaging 1.00
R1585:Spef2 UTSW 15 9596574 missense probably damaging 1.00
R1654:Spef2 UTSW 15 9634652 missense probably damaging 0.99
R1723:Spef2 UTSW 15 9614209 missense probably damaging 1.00
R1757:Spef2 UTSW 15 9717482 missense probably damaging 1.00
R1812:Spef2 UTSW 15 9679349 missense probably damaging 1.00
R1817:Spef2 UTSW 15 9584108 missense probably damaging 0.96
R1818:Spef2 UTSW 15 9584108 missense probably damaging 0.96
R1873:Spef2 UTSW 15 9584108 missense probably damaging 0.96
R1875:Spef2 UTSW 15 9584108 missense probably damaging 0.96
R1875:Spef2 UTSW 15 9597401 missense possibly damaging 0.78
R1897:Spef2 UTSW 15 9729654 nonsense probably null
R1901:Spef2 UTSW 15 9607377 missense probably damaging 1.00
R1902:Spef2 UTSW 15 9607377 missense probably damaging 1.00
R1943:Spef2 UTSW 15 9663194 missense possibly damaging 0.76
R1968:Spef2 UTSW 15 9609516 missense probably damaging 1.00
R1973:Spef2 UTSW 15 9663066 makesense probably null
R1998:Spef2 UTSW 15 9668903 critical splice acceptor site probably null
R1999:Spef2 UTSW 15 9668903 critical splice acceptor site probably null
R2008:Spef2 UTSW 15 9713185 missense possibly damaging 0.95
R2111:Spef2 UTSW 15 9589573 missense probably damaging 1.00
R2405:Spef2 UTSW 15 9626034 nonsense probably null
R2517:Spef2 UTSW 15 9725197 missense possibly damaging 0.93
R2889:Spef2 UTSW 15 9630613 missense probably damaging 0.99
R2988:Spef2 UTSW 15 9682623 missense probably benign 0.43
R3792:Spef2 UTSW 15 9704536 missense probably damaging 1.00
R4154:Spef2 UTSW 15 9626021 missense probably benign 0.13
R4159:Spef2 UTSW 15 9676321 missense probably damaging 1.00
R4199:Spef2 UTSW 15 9667280 missense probably damaging 1.00
R4320:Spef2 UTSW 15 9679343 missense possibly damaging 0.93
R4321:Spef2 UTSW 15 9679343 missense possibly damaging 0.93
R4568:Spef2 UTSW 15 9647217 missense probably damaging 1.00
R4625:Spef2 UTSW 15 9647438 missense probably damaging 1.00
R4669:Spef2 UTSW 15 9676373 missense probably benign 0.42
R4684:Spef2 UTSW 15 9647490 missense probably benign 0.44
R4761:Spef2 UTSW 15 9652954 missense probably damaging 1.00
R4839:Spef2 UTSW 15 9713178 nonsense probably null
R5004:Spef2 UTSW 15 9578327 missense probably benign 0.02
R5157:Spef2 UTSW 15 9668791 nonsense probably null
R5230:Spef2 UTSW 15 9667230 missense possibly damaging 0.62
R5315:Spef2 UTSW 15 9596691 missense probably damaging 0.98
R5400:Spef2 UTSW 15 9614281 missense probably damaging 1.00
R5591:Spef2 UTSW 15 9583836 missense probably benign 0.02
R5599:Spef2 UTSW 15 9729703 missense possibly damaging 0.53
R5605:Spef2 UTSW 15 9609520 missense probably damaging 0.96
R5787:Spef2 UTSW 15 9748726 missense possibly damaging 0.91
R5939:Spef2 UTSW 15 9614215 missense probably benign 0.16
R6177:Spef2 UTSW 15 9727532 missense possibly damaging 0.89
R6641:Spef2 UTSW 15 9625973 missense probably damaging 1.00
R6665:Spef2 UTSW 15 9600518 critical splice donor site probably null
R6944:Spef2 UTSW 15 9592749 missense probably damaging 1.00
R6956:Spef2 UTSW 15 9684935 missense probably damaging 1.00
R6968:Spef2 UTSW 15 9597340 missense probably benign 0.02
R7089:Spef2 UTSW 15 9725171 missense probably damaging 1.00
R7117:Spef2 UTSW 15 9729838 missense probably damaging 1.00
R7161:Spef2 UTSW 15 9717603 missense probably benign 0.29
R7223:Spef2 UTSW 15 9601640 missense unknown
R7263:Spef2 UTSW 15 9653012 splice site probably null
R7270:Spef2 UTSW 15 9599980 critical splice donor site probably null
R7303:Spef2 UTSW 15 9647490 missense possibly damaging 0.92
R7369:Spef2 UTSW 15 9584207 missense probably benign 0.02
R7464:Spef2 UTSW 15 9740585 missense probably benign 0.23
R7498:Spef2 UTSW 15 9727539 missense probably benign
R7587:Spef2 UTSW 15 9713219 missense probably damaging 1.00
R7748:Spef2 UTSW 15 9652945 missense probably damaging 0.98
R7772:Spef2 UTSW 15 9704481 missense probably damaging 0.99
R7838:Spef2 UTSW 15 9609551 missense possibly damaging 0.53
R7854:Spef2 UTSW 15 9596644 missense possibly damaging 0.77
R7855:Spef2 UTSW 15 9687895 missense possibly damaging 0.53
R7889:Spef2 UTSW 15 9717563 missense probably damaging 1.00
R7943:Spef2 UTSW 15 9601085 missense unknown
R8105:Spef2 UTSW 15 9682662 missense probably benign 0.06
R8151:Spef2 UTSW 15 9601512 missense unknown
R8296:Spef2 UTSW 15 9727543 missense probably benign 0.06
R8393:Spef2 UTSW 15 9676529 missense probably benign 0.27
R8405:Spef2 UTSW 15 9612557 missense probably benign 0.00
R8552:Spef2 UTSW 15 9600679 intron probably benign
R8691:Spef2 UTSW 15 9601919 nonsense probably null
R8751:Spef2 UTSW 15 9729637 nonsense probably null
R8847:Spef2 UTSW 15 9668827 missense probably benign
R8864:Spef2 UTSW 15 9599747 missense unknown
R8868:Spef2 UTSW 15 9729661 missense possibly damaging 0.53
R8916:Spef2 UTSW 15 9725180 nonsense probably null
X0025:Spef2 UTSW 15 9596622 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCAGTAGTGTGACTAGGAAGC -3'
(R):5'- ACCAACACTTCACCTGCTGG -3'

Sequencing Primer
(F):5'- TGAGCATAAAATAACACCCAGAAGG -3'
(R):5'- CTGGGTTTGCAGTTTGATCAGAATG -3'
Posted On2014-09-17