Incidental Mutation 'R2127:Gpr15'
ID227670
Institutional Source Beutler Lab
Gene Symbol Gpr15
Ensembl Gene ENSMUSG00000047293
Gene NameG protein-coupled receptor 15
Synonyms4933439K08Rik
MMRRC Submission 040130-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2127 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location58717433-58719070 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58718255 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 157 (V157A)
Ref Sequence ENSEMBL: ENSMUSP00000086731 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089318]
Predicted Effect possibly damaging
Transcript: ENSMUST00000089318
AA Change: V157A

PolyPhen 2 Score 0.669 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000086731
Gene: ENSMUSG00000047293
AA Change: V157A

DomainStartEndE-ValueType
Pfam:7tm_1 50 302 1.3e-46 PFAM
Pfam:7TM_GPCR_Srv 66 317 7.1e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231342
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232532
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (93/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a G protein-coupled receptor that acts as a chemokine receptor for human immunodeficiency virus type 1 and 2. The encoded protein localizes to the cell membrane. [provided by RefSeq, Nov 2012]
PHENOTYPE: Mice homozygous for a a knock-out allele exhibit impaired regulatory T cell homing in the large intestine mucosa. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449I24Rik T A 5: 146,504,942 S300T possibly damaging Het
4932431P20Rik T C 7: 29,537,140 noncoding transcript Het
A2ml1 A C 6: 128,558,437 V770G probably damaging Het
Abca6 A G 11: 110,219,649 I558T probably benign Het
Abhd17c C A 7: 84,110,662 G295W probably damaging Het
Actn3 G A 19: 4,871,675 A159V probably damaging Het
Adgrv1 A T 13: 81,557,080 F1537Y probably damaging Het
Agbl1 G T 7: 76,419,880 V373F possibly damaging Het
Aldh1a1 A T 19: 20,642,915 E485D probably benign Het
Amdhd2 A G 17: 24,158,308 probably null Het
Armc3 A G 2: 19,201,811 D15G probably damaging Het
Atp2b2 A G 6: 113,760,650 L921P probably damaging Het
Btbd16 A G 7: 130,784,308 N88S probably benign Het
Capn10 T A 1: 92,938,034 C77* probably null Het
Caskin1 T C 17: 24,496,996 probably null Het
Catsper4 T C 4: 134,213,806 D254G probably benign Het
Catsperg1 T C 7: 29,185,040 D958G probably damaging Het
Ccar2 T G 14: 70,139,651 K787Q probably benign Het
Ccdc191 C T 16: 43,908,635 T244I probably benign Het
Cd33 A T 7: 43,530,275 L243Q possibly damaging Het
Cdc37 T C 9: 21,149,847 Y4C probably damaging Het
Cenpe T G 3: 135,239,780 N1018K probably benign Het
Crocc G A 4: 141,017,096 R1830C probably damaging Het
Csmd1 T C 8: 15,917,392 D3157G probably damaging Het
Dhx57 C T 17: 80,273,048 V492M probably damaging Het
Dnah2 A T 11: 69,458,185 I2486N probably benign Het
Dnhd1 C T 7: 105,693,721 T1424I possibly damaging Het
Dsc3 C T 18: 19,968,354 A661T probably benign Het
F930015N05Rik A G 11: 64,435,403 probably benign Het
Fbxo34 C A 14: 47,530,106 R308S probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Gm11595 A T 11: 99,772,501 C118S unknown Het
Gm9742 A T 13: 8,034,975 noncoding transcript Het
Gmeb2 G A 2: 181,259,049 A185V probably benign Het
Gpr3 C T 4: 133,210,621 A247T probably damaging Het
Grin2b A C 6: 135,778,700 S539A probably benign Het
Hmbs T C 9: 44,340,707 T92A probably benign Het
Inpp4a A G 1: 37,366,919 M173V probably benign Het
Irx4 T A 13: 73,265,476 S22T probably benign Het
Jph3 C T 8: 121,785,142 A623V probably benign Het
Kif1b G A 4: 149,187,640 S1568L possibly damaging Het
Ksr1 G A 11: 79,033,313 S361L probably damaging Het
Lyst T G 13: 13,635,262 Y506D probably damaging Het
Mctp1 A G 13: 76,824,822 D648G probably damaging Het
Megf8 T C 7: 25,364,582 S2788P possibly damaging Het
Mfsd2b T A 12: 4,867,659 Y129F probably benign Het
Mindy4 T C 6: 55,218,265 S155P probably benign Het
Mospd4 A G 18: 46,465,664 noncoding transcript Het
Myo18b A T 5: 112,831,078 L1223Q probably damaging Het
Nckipsd A G 9: 108,811,733 T156A probably benign Het
Ndst1 G A 18: 60,691,208 T799I probably benign Het
Npffr2 A T 5: 89,568,065 I84F probably damaging Het
Nphp3 G A 9: 104,008,243 V167M probably damaging Het
Nup107 C A 10: 117,774,475 R354L possibly damaging Het
Olfml2a T C 2: 38,941,687 C93R probably damaging Het
Olfr1145 A G 2: 87,810,341 I174V probably benign Het
Olfr1157 A T 2: 87,962,832 V20D probably benign Het
Olfr384 C G 11: 73,602,805 S75C possibly damaging Het
Pappa T A 4: 65,297,257 L1134M probably damaging Het
Plscr4 T G 9: 92,488,630 F217V possibly damaging Het
Pnpla8 T A 12: 44,308,057 Y667N probably benign Het
Polg A G 7: 79,464,928 L95P probably damaging Het
Psg20 T G 7: 18,682,718 I158L probably damaging Het
Pwwp2a A G 11: 43,705,318 S437G probably benign Het
Rdx A G 9: 52,069,732 M305V possibly damaging Het
Rinl A G 7: 28,796,743 E383G probably damaging Het
Ror1 A G 4: 100,442,093 M888V probably benign Het
Rps12 A T 10: 23,786,878 I22K possibly damaging Het
Rtca C A 3: 116,497,674 R219L possibly damaging Het
Ryr2 G A 13: 11,712,195 P2427S probably damaging Het
Slc10a6 A G 5: 103,609,056 Y281H probably benign Het
Slc39a11 A G 11: 113,369,803 S176P probably benign Het
Slfn10-ps A G 11: 83,030,342 noncoding transcript Het
Spef2 T C 15: 9,729,661 T124A possibly damaging Het
Sult2a4 G T 7: 13,915,260 P207Q probably damaging Het
Tas1r3 G A 4: 155,860,470 R765C probably damaging Het
Tcstv1 T C 13: 119,893,746 T117A probably damaging Het
Tha1 A G 11: 117,869,774 V208A probably damaging Het
Tmbim4 T A 10: 120,224,753 I215N probably damaging Het
Tmem202 T A 9: 59,520,200 I122F probably benign Het
Tomm70a T C 16: 57,121,871 S4P unknown Het
Tpcn2 A G 7: 145,273,975 probably benign Het
Trim36 A T 18: 46,212,337 F10I probably benign Het
Usp30 A G 5: 114,111,163 E176G probably damaging Het
Usp8 T G 2: 126,737,575 probably null Het
Vmn1r32 T A 6: 66,553,549 Y81F probably benign Het
Vps36 G T 8: 22,218,289 probably null Het
Wnt3 A G 11: 103,812,648 H319R possibly damaging Het
Zfp319 A T 8: 95,323,763 probably benign Het
Zfp408 T C 2: 91,645,174 E545G probably damaging Het
Zfp799 C T 17: 32,819,498 R598Q possibly damaging Het
Zfp831 T C 2: 174,648,124 V1228A probably benign Het
Zfp938 T C 10: 82,226,042 D248G probably benign Het
Other mutations in Gpr15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Gpr15 APN 16 58718078 missense probably damaging 0.99
IGL02616:Gpr15 APN 16 58718204 missense probably damaging 1.00
IGL03381:Gpr15 APN 16 58717976 missense probably damaging 1.00
PIT4418001:Gpr15 UTSW 16 58717950 missense probably benign 0.13
R1484:Gpr15 UTSW 16 58718574 missense probably damaging 1.00
R1775:Gpr15 UTSW 16 58718558 missense probably benign 0.05
R1959:Gpr15 UTSW 16 58718007 missense probably benign 0.03
R1961:Gpr15 UTSW 16 58718007 missense probably benign 0.03
R3825:Gpr15 UTSW 16 58718360 missense probably damaging 1.00
R4957:Gpr15 UTSW 16 58718174 missense probably damaging 0.99
R5098:Gpr15 UTSW 16 58718527 missense probably damaging 1.00
R5180:Gpr15 UTSW 16 58717885 missense probably benign 0.07
R5668:Gpr15 UTSW 16 58717650 missense probably damaging 1.00
R6104:Gpr15 UTSW 16 58717976 missense probably damaging 1.00
R6281:Gpr15 UTSW 16 58718594 missense probably damaging 1.00
R6921:Gpr15 UTSW 16 58717781 missense probably benign 0.00
R6980:Gpr15 UTSW 16 58718742 start gained probably benign
R6981:Gpr15 UTSW 16 58718185 missense probably benign 0.44
R7252:Gpr15 UTSW 16 58718397 missense probably damaging 1.00
R7643:Gpr15 UTSW 16 58717816 nonsense probably null
R7680:Gpr15 UTSW 16 58717965 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCTGGTAATGAGCACACAG -3'
(R):5'- TCTAGGACTATGGAGGACTGGC -3'

Sequencing Primer
(F):5'- CCTTGTGATGCAACAGTAGC -3'
(R):5'- ACTATGGAGGACTGGCTCTTTCC -3'
Posted On2014-09-17