Incidental Mutation 'R2127:Dhx57'
ID 227675
Institutional Source Beutler Lab
Gene Symbol Dhx57
Ensembl Gene ENSMUSG00000035051
Gene Name DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57
Synonyms
MMRRC Submission 040130-MU
Accession Numbers

NCBI RefSeq: NM_001163759.1, NM_198942.2; MGI:2147067

Essential gene? Probably non essential (E-score: 0.112) question?
Stock # R2127 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 80238304-80290476 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 80273048 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 492 (V492M)
Ref Sequence ENSEMBL: ENSMUSP00000083742 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038166] [ENSMUST00000086555]
AlphaFold Q6P5D3
Predicted Effect possibly damaging
Transcript: ENSMUST00000038166
AA Change: V439M

PolyPhen 2 Score 0.516 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000041069
Gene: ENSMUSG00000035051
AA Change: V439M

DomainStartEndE-ValueType
low complexity region 6 50 N/A INTRINSIC
low complexity region 116 125 N/A INTRINSIC
UBA 129 166 1.04e-3 SMART
ZnF_C3H1 246 272 4.07e-6 SMART
low complexity region 357 368 N/A INTRINSIC
low complexity region 381 390 N/A INTRINSIC
low complexity region 423 432 N/A INTRINSIC
DEXDc 490 678 1.27e-28 SMART
Blast:DEXDc 688 752 2e-28 BLAST
HELICc 810 918 3.22e-16 SMART
HA2 984 1074 1.64e-24 SMART
Pfam:OB_NTP_bind 1113 1262 1.5e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000086555
AA Change: V492M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000083742
Gene: ENSMUSG00000035051
AA Change: V492M

DomainStartEndE-ValueType
low complexity region 6 50 N/A INTRINSIC
low complexity region 169 178 N/A INTRINSIC
UBA 182 219 1.04e-3 SMART
ZnF_C3H1 299 325 4.07e-6 SMART
low complexity region 410 421 N/A INTRINSIC
low complexity region 434 443 N/A INTRINSIC
low complexity region 476 485 N/A INTRINSIC
DEXDc 543 731 1.27e-28 SMART
Blast:DEXDc 741 805 1e-28 BLAST
HELICc 863 971 3.22e-16 SMART
HA2 1037 1127 1.64e-24 SMART
Pfam:OB_NTP_bind 1166 1315 8.5e-25 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (93/95)
Allele List at MGI

All alleles(25) : Gene trapped(25)

Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449I24Rik T A 5: 146,504,942 (GRCm38) S300T possibly damaging Het
4932431P20Rik T C 7: 29,537,140 (GRCm38) noncoding transcript Het
A2ml1 A C 6: 128,558,437 (GRCm38) V770G probably damaging Het
Abca6 A G 11: 110,219,649 (GRCm38) I558T probably benign Het
Abhd17c C A 7: 84,110,662 (GRCm38) G295W probably damaging Het
Actn3 G A 19: 4,871,675 (GRCm38) A159V probably damaging Het
Adgrv1 A T 13: 81,557,080 (GRCm38) F1537Y probably damaging Het
Agbl1 G T 7: 76,419,880 (GRCm38) V373F possibly damaging Het
Aldh1a1 A T 19: 20,642,915 (GRCm38) E485D probably benign Het
Amdhd2 A G 17: 24,158,308 (GRCm38) probably null Het
Armc3 A G 2: 19,201,811 (GRCm38) D15G probably damaging Het
Atp2b2 A G 6: 113,760,650 (GRCm38) L921P probably damaging Het
Btbd16 A G 7: 130,784,308 (GRCm38) N88S probably benign Het
Capn10 T A 1: 92,938,034 (GRCm38) C77* probably null Het
Caskin1 T C 17: 24,496,996 (GRCm38) probably null Het
Catsper4 T C 4: 134,213,806 (GRCm38) D254G probably benign Het
Catsperg1 T C 7: 29,185,040 (GRCm38) D958G probably damaging Het
Ccar2 T G 14: 70,139,651 (GRCm38) K787Q probably benign Het
Ccdc191 C T 16: 43,908,635 (GRCm38) T244I probably benign Het
Cd33 A T 7: 43,530,275 (GRCm38) L243Q possibly damaging Het
Cdc37 T C 9: 21,149,847 (GRCm38) Y4C probably damaging Het
Cenpe T G 3: 135,239,780 (GRCm38) N1018K probably benign Het
Crocc G A 4: 141,017,096 (GRCm38) R1830C probably damaging Het
Csmd1 T C 8: 15,917,392 (GRCm38) D3157G probably damaging Het
Dnah2 A T 11: 69,458,185 (GRCm38) I2486N probably benign Het
Dnhd1 C T 7: 105,693,721 (GRCm38) T1424I possibly damaging Het
Dsc3 C T 18: 19,968,354 (GRCm38) A661T probably benign Het
F930015N05Rik A G 11: 64,435,403 (GRCm38) probably benign Het
Fbxo34 C A 14: 47,530,106 (GRCm38) R308S probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 (GRCm38) probably benign Het
Gm11595 A T 11: 99,772,501 (GRCm38) C118S unknown Het
Gm9742 A T 13: 8,034,975 (GRCm38) noncoding transcript Het
Gmeb2 G A 2: 181,259,049 (GRCm38) A185V probably benign Het
Gpr15 A G 16: 58,718,255 (GRCm38) V157A possibly damaging Het
Gpr3 C T 4: 133,210,621 (GRCm38) A247T probably damaging Het
Grin2b A C 6: 135,778,700 (GRCm38) S539A probably benign Het
Hmbs T C 9: 44,340,707 (GRCm38) T92A probably benign Het
Inpp4a A G 1: 37,366,919 (GRCm38) M173V probably benign Het
Irx4 T A 13: 73,265,476 (GRCm38) S22T probably benign Het
Jph3 C T 8: 121,785,142 (GRCm38) A623V probably benign Het
Kif1b G A 4: 149,187,640 (GRCm38) S1568L possibly damaging Het
Ksr1 G A 11: 79,033,313 (GRCm38) S361L probably damaging Het
Lyst T G 13: 13,635,262 (GRCm38) Y506D probably damaging Het
Mctp1 A G 13: 76,824,822 (GRCm38) D648G probably damaging Het
Megf8 T C 7: 25,364,582 (GRCm38) S2788P possibly damaging Het
Mfsd2b T A 12: 4,867,659 (GRCm38) Y129F probably benign Het
Mindy4 T C 6: 55,218,265 (GRCm38) S155P probably benign Het
Mospd4 A G 18: 46,465,664 (GRCm38) noncoding transcript Het
Myo18b A T 5: 112,831,078 (GRCm38) L1223Q probably damaging Het
Nckipsd A G 9: 108,811,733 (GRCm38) T156A probably benign Het
Ndst1 G A 18: 60,691,208 (GRCm38) T799I probably benign Het
Npffr2 A T 5: 89,568,065 (GRCm38) I84F probably damaging Het
Nphp3 G A 9: 104,008,243 (GRCm38) V167M probably damaging Het
Nup107 C A 10: 117,774,475 (GRCm38) R354L possibly damaging Het
Olfml2a T C 2: 38,941,687 (GRCm38) C93R probably damaging Het
Olfr1145 A G 2: 87,810,341 (GRCm38) I174V probably benign Het
Olfr1157 A T 2: 87,962,832 (GRCm38) V20D probably benign Het
Olfr384 C G 11: 73,602,805 (GRCm38) S75C possibly damaging Het
Pappa T A 4: 65,297,257 (GRCm38) L1134M probably damaging Het
Plscr4 T G 9: 92,488,630 (GRCm38) F217V possibly damaging Het
Pnpla8 T A 12: 44,308,057 (GRCm38) Y667N probably benign Het
Polg A G 7: 79,464,928 (GRCm38) L95P probably damaging Het
Psg20 T G 7: 18,682,718 (GRCm38) I158L probably damaging Het
Pwwp2a A G 11: 43,705,318 (GRCm38) S437G probably benign Het
Rdx A G 9: 52,069,732 (GRCm38) M305V possibly damaging Het
Rinl A G 7: 28,796,743 (GRCm38) E383G probably damaging Het
Ror1 A G 4: 100,442,093 (GRCm38) M888V probably benign Het
Rps12 A T 10: 23,786,878 (GRCm38) I22K possibly damaging Het
Rtca C A 3: 116,497,674 (GRCm38) R219L possibly damaging Het
Ryr2 G A 13: 11,712,195 (GRCm38) P2427S probably damaging Het
Slc10a6 A G 5: 103,609,056 (GRCm38) Y281H probably benign Het
Slc39a11 A G 11: 113,369,803 (GRCm38) S176P probably benign Het
Slfn10-ps A G 11: 83,030,342 (GRCm38) noncoding transcript Het
Spef2 T C 15: 9,729,661 (GRCm38) T124A possibly damaging Het
Sult2a4 G T 7: 13,915,260 (GRCm38) P207Q probably damaging Het
Tas1r3 G A 4: 155,860,470 (GRCm38) R765C probably damaging Het
Tcstv1 T C 13: 119,893,746 (GRCm38) T117A probably damaging Het
Tha1 A G 11: 117,869,774 (GRCm38) V208A probably damaging Het
Tmbim4 T A 10: 120,224,753 (GRCm38) I215N probably damaging Het
Tmem202 T A 9: 59,520,200 (GRCm38) I122F probably benign Het
Tomm70a T C 16: 57,121,871 (GRCm38) S4P unknown Het
Tpcn2 A G 7: 145,273,975 (GRCm38) probably benign Het
Trim36 A T 18: 46,212,337 (GRCm38) F10I probably benign Het
Usp30 A G 5: 114,111,163 (GRCm38) E176G probably damaging Het
Usp8 T G 2: 126,737,575 (GRCm38) probably null Het
Vmn1r32 T A 6: 66,553,549 (GRCm38) Y81F probably benign Het
Vps36 G T 8: 22,218,289 (GRCm38) probably null Het
Wnt3 A G 11: 103,812,648 (GRCm38) H319R possibly damaging Het
Zfp319 A T 8: 95,323,763 (GRCm38) probably benign Het
Zfp408 T C 2: 91,645,174 (GRCm38) E545G probably damaging Het
Zfp799 C T 17: 32,819,498 (GRCm38) R598Q possibly damaging Het
Zfp831 T C 2: 174,648,124 (GRCm38) V1228A probably benign Het
Zfp938 T C 10: 82,226,042 (GRCm38) D248G probably benign Het
Other mutations in Dhx57
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00642:Dhx57 APN 17 80,274,976 (GRCm38) missense probably benign 0.00
IGL00811:Dhx57 APN 17 80,253,243 (GRCm38) missense probably damaging 1.00
IGL01389:Dhx57 APN 17 80,281,223 (GRCm38) missense probably benign 0.28
IGL01468:Dhx57 APN 17 80,255,610 (GRCm38) nonsense probably null
IGL01908:Dhx57 APN 17 80,251,443 (GRCm38) missense probably damaging 1.00
IGL01965:Dhx57 APN 17 80,268,850 (GRCm38) missense probably damaging 1.00
IGL02147:Dhx57 APN 17 80,260,323 (GRCm38) missense possibly damaging 0.95
IGL02275:Dhx57 APN 17 80,274,839 (GRCm38) missense probably benign 0.13
IGL02349:Dhx57 APN 17 80,255,571 (GRCm38) missense probably damaging 1.00
IGL02405:Dhx57 APN 17 80,255,550 (GRCm38) critical splice donor site probably null
IGL02588:Dhx57 APN 17 80,268,871 (GRCm38) missense probably damaging 1.00
IGL02673:Dhx57 APN 17 80,267,545 (GRCm38) missense probably damaging 1.00
IGL02836:Dhx57 APN 17 80,267,549 (GRCm38) missense probably damaging 1.00
IGL02889:Dhx57 APN 17 80,247,152 (GRCm38) missense possibly damaging 0.90
IGL03085:Dhx57 APN 17 80,258,097 (GRCm38) missense possibly damaging 0.48
P0014:Dhx57 UTSW 17 80,275,191 (GRCm38) missense probably benign 0.00
PIT4377001:Dhx57 UTSW 17 80,263,975 (GRCm38) missense probably damaging 0.96
R0100:Dhx57 UTSW 17 80,275,156 (GRCm38) missense possibly damaging 0.82
R0100:Dhx57 UTSW 17 80,275,156 (GRCm38) missense possibly damaging 0.82
R0129:Dhx57 UTSW 17 80,238,914 (GRCm38) missense probably damaging 1.00
R0200:Dhx57 UTSW 17 80,251,473 (GRCm38) missense probably damaging 1.00
R0309:Dhx57 UTSW 17 80,274,881 (GRCm38) missense probably damaging 1.00
R0375:Dhx57 UTSW 17 80,258,121 (GRCm38) missense probably damaging 1.00
R0396:Dhx57 UTSW 17 80,274,797 (GRCm38) missense probably benign 0.34
R0520:Dhx57 UTSW 17 80,258,175 (GRCm38) missense possibly damaging 0.95
R0554:Dhx57 UTSW 17 80,260,236 (GRCm38) nonsense probably null
R0661:Dhx57 UTSW 17 80,268,864 (GRCm38) missense probably damaging 1.00
R0883:Dhx57 UTSW 17 80,270,371 (GRCm38) missense probably damaging 1.00
R0900:Dhx57 UTSW 17 80,275,582 (GRCm38) missense probably benign
R0963:Dhx57 UTSW 17 80,275,527 (GRCm38) missense probably benign 0.01
R1469:Dhx57 UTSW 17 80,254,418 (GRCm38) missense probably damaging 1.00
R1469:Dhx57 UTSW 17 80,254,418 (GRCm38) missense probably damaging 1.00
R1660:Dhx57 UTSW 17 80,245,728 (GRCm38) missense possibly damaging 0.83
R1707:Dhx57 UTSW 17 80,275,226 (GRCm38) missense probably damaging 0.96
R1822:Dhx57 UTSW 17 80,253,085 (GRCm38) critical splice donor site probably null
R1853:Dhx57 UTSW 17 80,274,879 (GRCm38) nonsense probably null
R1942:Dhx57 UTSW 17 80,265,144 (GRCm38) missense probably damaging 1.00
R2043:Dhx57 UTSW 17 80,253,080 (GRCm38) splice site probably benign
R2106:Dhx57 UTSW 17 80,275,363 (GRCm38) missense probably damaging 1.00
R2183:Dhx57 UTSW 17 80,275,331 (GRCm38) missense probably benign 0.07
R2249:Dhx57 UTSW 17 80,281,234 (GRCm38) missense probably damaging 0.98
R2400:Dhx57 UTSW 17 80,260,416 (GRCm38) missense probably damaging 0.99
R2404:Dhx57 UTSW 17 80,254,304 (GRCm38) missense probably damaging 0.98
R2513:Dhx57 UTSW 17 80,241,949 (GRCm38) splice site probably null
R2869:Dhx57 UTSW 17 80,251,376 (GRCm38) missense probably benign 0.22
R2869:Dhx57 UTSW 17 80,251,376 (GRCm38) missense probably benign 0.22
R2870:Dhx57 UTSW 17 80,251,376 (GRCm38) missense probably benign 0.22
R2870:Dhx57 UTSW 17 80,251,376 (GRCm38) missense probably benign 0.22
R2871:Dhx57 UTSW 17 80,251,376 (GRCm38) missense probably benign 0.22
R2871:Dhx57 UTSW 17 80,251,376 (GRCm38) missense probably benign 0.22
R2874:Dhx57 UTSW 17 80,251,376 (GRCm38) missense probably benign 0.22
R3819:Dhx57 UTSW 17 80,265,074 (GRCm38) critical splice donor site probably null
R3964:Dhx57 UTSW 17 80,265,112 (GRCm38) nonsense probably null
R4535:Dhx57 UTSW 17 80,275,082 (GRCm38) missense probably damaging 1.00
R4666:Dhx57 UTSW 17 80,274,961 (GRCm38) missense probably damaging 1.00
R4788:Dhx57 UTSW 17 80,275,331 (GRCm38) missense probably benign 0.01
R4822:Dhx57 UTSW 17 80,242,167 (GRCm38) splice site probably null
R4863:Dhx57 UTSW 17 80,253,111 (GRCm38) missense probably damaging 1.00
R4988:Dhx57 UTSW 17 80,251,398 (GRCm38) missense probably damaging 1.00
R5391:Dhx57 UTSW 17 80,275,081 (GRCm38) missense probably damaging 1.00
R5559:Dhx57 UTSW 17 80,254,379 (GRCm38) missense possibly damaging 0.53
R5644:Dhx57 UTSW 17 80,238,873 (GRCm38) missense possibly damaging 0.73
R5997:Dhx57 UTSW 17 80,245,806 (GRCm38) missense probably damaging 0.96
R6090:Dhx57 UTSW 17 80,263,946 (GRCm38) critical splice donor site probably null
R6177:Dhx57 UTSW 17 80,272,966 (GRCm38) missense possibly damaging 0.91
R6283:Dhx57 UTSW 17 80,274,805 (GRCm38) missense probably benign 0.00
R6802:Dhx57 UTSW 17 80,275,321 (GRCm38) missense probably benign 0.43
R6924:Dhx57 UTSW 17 80,238,815 (GRCm38) missense possibly damaging 0.71
R7151:Dhx57 UTSW 17 80,273,047 (GRCm38) missense probably damaging 1.00
R7386:Dhx57 UTSW 17 80,267,577 (GRCm38) missense possibly damaging 0.89
R7393:Dhx57 UTSW 17 80,255,571 (GRCm38) missense probably damaging 1.00
R7451:Dhx57 UTSW 17 80,247,113 (GRCm38) missense probably damaging 1.00
R7602:Dhx57 UTSW 17 80,274,861 (GRCm38) missense probably benign 0.06
R7733:Dhx57 UTSW 17 80,265,074 (GRCm38) critical splice donor site probably null
R7748:Dhx57 UTSW 17 80,265,117 (GRCm38) missense probably damaging 1.00
R7749:Dhx57 UTSW 17 80,238,858 (GRCm38) missense probably benign 0.04
R7772:Dhx57 UTSW 17 80,273,078 (GRCm38) missense possibly damaging 0.71
R8213:Dhx57 UTSW 17 80,275,156 (GRCm38) missense possibly damaging 0.82
R8370:Dhx57 UTSW 17 80,245,763 (GRCm38) missense probably damaging 1.00
R8371:Dhx57 UTSW 17 80,275,490 (GRCm38) missense probably benign 0.18
R8403:Dhx57 UTSW 17 80,278,289 (GRCm38) missense probably damaging 1.00
R8467:Dhx57 UTSW 17 80,254,424 (GRCm38) missense probably damaging 1.00
R8690:Dhx57 UTSW 17 80,270,365 (GRCm38) critical splice donor site probably benign
R9210:Dhx57 UTSW 17 80,268,909 (GRCm38) missense probably damaging 1.00
R9212:Dhx57 UTSW 17 80,268,909 (GRCm38) missense probably damaging 1.00
R9447:Dhx57 UTSW 17 80,242,094 (GRCm38) missense probably damaging 1.00
R9562:Dhx57 UTSW 17 80,254,388 (GRCm38) missense probably damaging 1.00
R9669:Dhx57 UTSW 17 80,245,701 (GRCm38) missense probably benign 0.09
R9717:Dhx57 UTSW 17 80,275,018 (GRCm38) missense probably damaging 1.00
Z1088:Dhx57 UTSW 17 80,251,348 (GRCm38) missense probably damaging 1.00
Z1176:Dhx57 UTSW 17 80,245,805 (GRCm38) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GGAGTTTTAACGTTCAGAGCAAAC -3'
(R):5'- TCCCTGTTTCAGAGCAGTATGG -3'

Sequencing Primer
(F):5'- TTTAACGTTCAGAGCAAACCAAAAG -3'
(R):5'- GAAGTTGTTTCAGTCAAACCTCAGGG -3'
Posted On 2014-09-17