Mutagenetix > Incidental Mutation

Incidental Mutation 'R2128:Rabgap1l'

227687

Institutional Source

Beutler Lab

Gene Symbol

Rabgap1l

Ensembl Gene

ENSMUSG00000026721

Gene Name

RAB GTPase activating protein 1-like

Synonyms

Hh1, 8430421H08Rik, 5830411O09Rik, 9630005B12Rik

MMRRC Submission

040131-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2128 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

160219174-160793211 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 160738957 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 90 (D90E)

Ref Sequence

ENSEMBL: ENSMUSP00000141749 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028049] [ENSMUST00000193810] [ENSMUST00000195442]

AlphaFold

A6H6A9

Predicted Effect

probably benign
Transcript: ENSMUST00000028049
AA Change: D90E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000028049
Gene: ENSMUSG00000026721
AA Change: D90E

Domain	Start	End	E-Value	Type
low complexity region	113	124	N/A	INTRINSIC
PTB	127	260	4.47e-20	SMART
Pfam:DUF3694	290	421	8.1e-41	PFAM
low complexity region	483	496	N/A	INTRINSIC
TBC	535	747	5.13e-67	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000193810
AA Change: D90E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000141749
Gene: ENSMUSG00000026721
AA Change: D90E

Domain	Start	End	E-Value	Type
low complexity region	113	124	N/A	INTRINSIC
Blast:PTB	127	147	6e-6	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000195442
AA Change: D62E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000141666
Gene: ENSMUSG00000026721
AA Change: D62E

Domain	Start	End	E-Value	Type
low complexity region	85	96	N/A	INTRINSIC
PTB	99	232	4.47e-20	SMART
Pfam:DUF3694	262	394	1.4e-42	PFAM

Meta Mutation Damage Score

0.0625

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a gene trap insertion are viable, fertile and overtly normal with no alterations in hematopoietic progenitor cell numbers or types. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 94 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700113H08Rik	A	G	10: 87,230,204	E249G	possibly damaging	Het
2610028H24Rik	A	G	10: 76,457,515	M136V	possibly damaging	Het
4930523C07Rik	A	T	1: 160,075,375	K72*	probably null	Het
Abca6	A	G	11: 110,219,649	I558T	probably benign	Het
Acot10	T	C	15: 20,666,626	T10A	probably benign	Het
Adgrl4	T	A	3: 151,500,201	D233E	probably benign	Het
Adgrv1	A	T	13: 81,557,080	F1537Y	probably damaging	Het
Akap2	A	G	4: 57,854,890	Y134C	probably benign	Het
Aqp3	T	A	4: 41,098,061	I17F	probably benign	Het
Arap1	T	A	7: 101,409,320	L1375H	probably damaging	Het
Aspm	T	C	1: 139,457,635	V339A	probably benign	Het
Atp13a3	G	A	16: 30,354,276	A261V	probably damaging	Het
Casp8ap2	T	C	4: 32,640,142	Y399H	probably benign	Het
Cept1	A	G	3: 106,512,879	V213A	probably damaging	Het
Cit	A	G	5: 115,985,507	D1469G	possibly damaging	Het
Cnga2	A	G	X: 72,007,788	Y182C	possibly damaging	Het
Cox20	A	G	1: 178,321,947	I54V	probably benign	Het
Dhx8	C	A	11: 101,738,409	D261E	probably benign	Het
Dnah2	A	T	11: 69,458,185	I2486N	probably benign	Het
Dnah5	A	G	15: 28,408,321	Q3484R	probably benign	Het
Drd1	T	C	13: 54,053,553	Y207C	probably damaging	Het
Dtl	C	T	1: 191,558,110	V222I	probably damaging	Het
Dync1h1	T	C	12: 110,640,882	Y2636H	probably damaging	Het
Endog	C	A	2: 30,172,036	D154E	probably benign	Het
Epc1	A	T	18: 6,462,954	V14E	probably damaging	Het
Ercc4	C	A	16: 13,147,934	T810K	probably damaging	Het
Fam43b	T	A	4: 138,395,988	N7I	possibly damaging	Het
Fgd1	T	C	X: 151,086,217		probably null	Het
Filip1	G	T	9: 79,819,330	T669N	probably damaging	Het
Fndc1	A	G	17: 7,778,665		probably benign	Het
Foxk1	C	A	5: 142,435,188	S189*	probably null	Het
Gatm	T	C	2: 122,600,536	N274S	probably damaging	Het
Gdf9	A	G	11: 53,437,507	Y430C	probably damaging	Het
Gga1	C	T	15: 78,888,448	P260S	probably damaging	Het
Gm11595	A	T	11: 99,772,501	C118S	unknown	Het
Gm382	G	T	X: 127,062,651	V820L	possibly damaging	Het
Gzmk	T	A	13: 113,172,014	I179F	probably damaging	Het
Hsp90b1	T	C	10: 86,695,706	D421G	probably damaging	Het
Hus1	A	G	11: 9,006,011	M174T	probably damaging	Het
Ifngr2	T	A	16: 91,562,873	Y289*	probably null	Het
Il6st	T	A	13: 112,504,175	H828Q	probably benign	Het
Impg2	T	A	16: 56,218,379	Y127N	probably damaging	Het
Irf3	T	A	7: 45,001,744	W345R	probably damaging	Het
Kif1b	G	A	4: 149,187,640	S1568L	possibly damaging	Het
Klhl42	A	G	6: 147,101,753	T342A	probably benign	Het
Kndc1	G	T	7: 139,930,112	R1289L	probably damaging	Het
Knl1	A	T	2: 119,071,819	T1334S	possibly damaging	Het
L3mbtl3	G	T	10: 26,313,868	D499E	unknown	Het
Ldhd	T	A	8: 111,627,048	M478L	probably benign	Het
Loxl4	C	G	19: 42,603,963	E385D	probably damaging	Het
Lrriq1	G	A	10: 103,214,857	T678I	probably benign	Het
Macf1	T	A	4: 123,492,774	I1017F	probably benign	Het
Madcam1	A	G	10: 79,665,572	E157G	possibly damaging	Het
Mamdc4	T	C	2: 25,569,258	D195G	probably damaging	Het
Mctp1	A	G	13: 76,824,822	D648G	probably damaging	Het
Mycbp2	T	C	14: 103,201,230	M2072V	probably benign	Het
Nck1	A	G	9: 100,497,547		probably null	Het
Ndufaf4	G	T	4: 24,898,608	D55Y	probably damaging	Het
Nek11	A	T	9: 105,300,361	D230E	probably benign	Het
Nit2	T	C	16: 57,161,196	K67E	possibly damaging	Het
Olfr2	T	C	7: 107,001,248	D204G	probably damaging	Het
Olfr290	T	C	7: 84,916,493	F238S	probably damaging	Het
Olfr527	C	T	7: 140,336,429	T189M	probably damaging	Het
Olfr802	A	T	10: 129,682,532	V69E	possibly damaging	Het
Pccb	G	C	9: 100,985,831	D347E	probably damaging	Het
Plcl1	T	A	1: 55,697,838	F779L	probably damaging	Het
Prune2	C	A	19: 17,122,422	D1763E	probably benign	Het
Pwwp2a	A	G	11: 43,705,318	S437G	probably benign	Het
Rapgef4	T	A	2: 72,226,553	I552N	possibly damaging	Het
Scn7a	A	T	2: 66,697,986	I720K	probably damaging	Het
Scn9a	T	A	2: 66,526,654	N1101I	probably damaging	Het
Siglec1	A	T	2: 131,080,497	Y553N	probably damaging	Het
Slc22a23	A	G	13: 34,203,970	L381P	possibly damaging	Het
Slc7a11	T	A	3: 50,384,109	T284S	probably damaging	Het
Slc8a2	T	A	7: 16,140,492		probably null	Het
Snx29	T	A	16: 11,400,971	S224T	probably damaging	Het
Stox1	T	C	10: 62,664,535	T749A	probably benign	Het
Tg	A	G	15: 66,694,894	I1264V	probably benign	Het
Tmem110	T	C	14: 30,866,624	Y103H	probably damaging	Het
Top2a	A	C	11: 99,009,807	V609G	probably damaging	Het
Trmt44	G	A	5: 35,574,832	P72S	probably benign	Het
Ttll3	G	C	6: 113,412,934	S760T	probably benign	Het
Ttn	T	C	2: 76,748,678	D23957G	probably damaging	Het
Ttn	G	A	2: 76,833,897		probably benign	Het
Ubxn1	T	G	19: 8,872,070	V59G	probably benign	Het
Ubxn4	T	C	1: 128,244,510	S14P	probably benign	Het
Uso1	T	A	5: 92,195,370	M771K	probably benign	Het
Utp20	A	G	10: 88,814,055	F431S	probably damaging	Het
Vmn1r206	T	C	13: 22,620,612	S142G	probably benign	Het
Vmn2r19	A	G	6: 123,308,330		probably null	Het
Vps36	G	T	8: 22,218,289		probably null	Het
Wnt3	A	G	11: 103,812,648	H319R	possibly damaging	Het
Zbtb26	G	T	2: 37,436,551	Q158K	probably benign	Het
Zfp648	T	C	1: 154,204,607	S171P	probably benign	Het

Other mutations in Rabgap1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01095:Rabgap1l	APN	1	160738969	missense	probably benign	0.02
IGL01309:Rabgap1l	APN	1	160700798	missense	probably benign	0.00
IGL01448:Rabgap1l	APN	1	160740745	splice site	probably benign
IGL01886:Rabgap1l	APN	1	160342042	missense	probably damaging	1.00
IGL02010:Rabgap1l	APN	1	160472071	missense	probably damaging	0.99
IGL02079:Rabgap1l	APN	1	160738970	missense	probably benign	0.00
IGL02800:Rabgap1l	APN	1	160472053	missense	possibly damaging	0.73
IGL03343:Rabgap1l	APN	1	160443283	missense	probably benign
IGL03388:Rabgap1l	APN	1	160733523	splice site	probably null
IGL03406:Rabgap1l	APN	1	160722169	missense	probably damaging	1.00
amerigo	UTSW	1	160724036	missense	probably damaging	1.00
hispaniola	UTSW	1	160645307	critical splice donor site	probably null
R0047:Rabgap1l	UTSW	1	160231789	splice site	probably benign
R0047:Rabgap1l	UTSW	1	160231789	splice site	probably benign
R0048:Rabgap1l	UTSW	1	160627369	splice site	probably benign
R0099:Rabgap1l	UTSW	1	160682116	missense	possibly damaging	0.89
R0201:Rabgap1l	UTSW	1	160453745	splice site	probably benign
R0432:Rabgap1l	UTSW	1	160722205	missense	probably benign	0.10
R1104:Rabgap1l	UTSW	1	160231875	splice site	probably benign
R1220:Rabgap1l	UTSW	1	160738909	missense	probably damaging	1.00
R1485:Rabgap1l	UTSW	1	160733680	missense	probably benign	0.06
R1569:Rabgap1l	UTSW	1	160702390	missense	probably benign	0.08
R1907:Rabgap1l	UTSW	1	160645310	missense	probably benign	0.07
R2129:Rabgap1l	UTSW	1	160738957	missense	probably benign	0.00
R2177:Rabgap1l	UTSW	1	160724062	missense	possibly damaging	0.89
R4636:Rabgap1l	UTSW	1	160342090	splice site	probably null
R4722:Rabgap1l	UTSW	1	160342164	missense	possibly damaging	0.81
R4743:Rabgap1l	UTSW	1	160453783	missense	probably damaging	1.00
R4913:Rabgap1l	UTSW	1	160238541	missense	probably damaging	1.00
R4915:Rabgap1l	UTSW	1	160441842	missense	probably benign	0.01
R5035:Rabgap1l	UTSW	1	160724036	missense	probably damaging	1.00
R5087:Rabgap1l	UTSW	1	160722239	missense	probably damaging	1.00
R5437:Rabgap1l	UTSW	1	160722147	missense	probably damaging	1.00
R5507:Rabgap1l	UTSW	1	160351328	missense	possibly damaging	0.83
R5619:Rabgap1l	UTSW	1	160238572	missense	probably benign	0.00
R5691:Rabgap1l	UTSW	1	160735684	missense	probably damaging	1.00
R5837:Rabgap1l	UTSW	1	160307222	utr 3 prime	probably benign
R5881:Rabgap1l	UTSW	1	160342113	missense	probably damaging	1.00
R6045:Rabgap1l	UTSW	1	160645323	missense	probably benign	0.00
R6243:Rabgap1l	UTSW	1	160645307	critical splice donor site	probably null
R6294:Rabgap1l	UTSW	1	160231849	missense	probably benign	0.14
R6452:Rabgap1l	UTSW	1	160453761	missense	probably damaging	1.00
R6802:Rabgap1l	UTSW	1	160733680	missense	probably benign	0.06
R6945:Rabgap1l	UTSW	1	160682182	missense	probably benign	0.29
R7014:Rabgap1l	UTSW	1	160342072	missense	probably damaging	1.00
R7062:Rabgap1l	UTSW	1	160226650	missense	probably benign
R7089:Rabgap1l	UTSW	1	160724172	nonsense	probably null
R7170:Rabgap1l	UTSW	1	160645365	missense	probably damaging	1.00
R7172:Rabgap1l	UTSW	1	160733586	missense	probably benign	0.05
R7303:Rabgap1l	UTSW	1	160682097	missense	probably benign	0.01
R7357:Rabgap1l	UTSW	1	160342038	missense	probably damaging	1.00
R7466:Rabgap1l	UTSW	1	160226484	critical splice donor site	probably null
R7501:Rabgap1l	UTSW	1	160700788	missense	probably damaging	0.98
R7565:Rabgap1l	UTSW	1	160251417	missense
R7582:Rabgap1l	UTSW	1	160682084	missense	probably benign
R7740:Rabgap1l	UTSW	1	160682103	missense	probably benign	0.01
R7978:Rabgap1l	UTSW	1	160251268	missense
R7993:Rabgap1l	UTSW	1	160700854	missense	probably damaging	1.00
R8116:Rabgap1l	UTSW	1	160702442	missense	probably benign	0.22
R8672:Rabgap1l	UTSW	1	160443276	missense	probably damaging	1.00
R8986:Rabgap1l	UTSW	1	160257535	missense	probably damaging	0.99
R9010:Rabgap1l	UTSW	1	160700873	missense	possibly damaging	0.80
R9286:Rabgap1l	UTSW	1	160224248	nonsense	probably null
Z1177:Rabgap1l	UTSW	1	160739073	missense	possibly damaging	0.82

Predicted Primers

PCR Primer
(F):5'- GGAATATGCATACAATGACACAGGC -3'
(R):5'- CCTTTTGTGAAGTGAACCCCTC -3'

Sequencing Primer
(F):5'- TACAATGACACAGGCACACATATAC -3'
(R):5'- ATGTGAGTACGCCATCACTG -3'

Posted On

2014-09-17