Incidental Mutation 'R2128:Cox20'
ID227688
Institutional Source Beutler Lab
Gene Symbol Cox20
Ensembl Gene ENSMUSG00000026500
Gene NameCOX20 Cox2 chaperone
Synonyms
MMRRC Submission 040131-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2128 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location178319130-178322693 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 178321947 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 54 (I54V)
Ref Sequence ENSEMBL: ENSMUSP00000027781 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027781] [ENSMUST00000037748] [ENSMUST00000161769]
Predicted Effect probably benign
Transcript: ENSMUST00000027781
AA Change: I54V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000027781
Gene: ENSMUSG00000026500
AA Change: I54V

DomainStartEndE-ValueType
Pfam:DUF3767 9 104 5.4e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000037748
SMART Domains Protein: ENSMUSP00000047571
Gene: ENSMUSG00000039630

DomainStartEndE-ValueType
SAP 8 42 3.57e-11 SMART
low complexity region 70 96 N/A INTRINSIC
low complexity region 101 154 N/A INTRINSIC
low complexity region 155 171 N/A INTRINSIC
low complexity region 173 184 N/A INTRINSIC
low complexity region 194 207 N/A INTRINSIC
SPRY 307 439 2.35e-34 SMART
Pfam:AAA_33 475 619 2e-30 PFAM
coiled coil region 626 653 N/A INTRINSIC
low complexity region 657 675 N/A INTRINSIC
low complexity region 676 732 N/A INTRINSIC
low complexity region 736 750 N/A INTRINSIC
low complexity region 753 791 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141846
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154437
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159117
Predicted Effect probably benign
Transcript: ENSMUST00000161769
SMART Domains Protein: ENSMUSP00000124147
Gene: ENSMUSG00000039630

DomainStartEndE-ValueType
SAP 8 42 3.57e-11 SMART
low complexity region 70 96 N/A INTRINSIC
low complexity region 101 154 N/A INTRINSIC
low complexity region 155 171 N/A INTRINSIC
low complexity region 173 184 N/A INTRINSIC
low complexity region 194 207 N/A INTRINSIC
SPRY 307 439 2.35e-34 SMART
Pfam:AAA_33 475 619 6.7e-31 PFAM
coiled coil region 626 653 N/A INTRINSIC
low complexity region 657 675 N/A INTRINSIC
low complexity region 676 732 N/A INTRINSIC
low complexity region 736 750 N/A INTRINSIC
low complexity region 753 773 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162916
Predicted Effect probably benign
Transcript: ENSMUST00000188044
Predicted Effect probably benign
Transcript: ENSMUST00000189450
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that plays a role in the assembly of cytochrome C oxidase, an important component of the respiratory pathway. It contains two transmembrane helices and localizes to the mitochondrial membrane. Mutations in this gene can cause mitochondrial complex IV deficiency, which results in ataxia and muscle hypotonia. There are multiple pseudogenes for this gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik A G 10: 87,230,204 E249G possibly damaging Het
2610028H24Rik A G 10: 76,457,515 M136V possibly damaging Het
4930523C07Rik A T 1: 160,075,375 K72* probably null Het
Abca6 A G 11: 110,219,649 I558T probably benign Het
Acot10 T C 15: 20,666,626 T10A probably benign Het
Adgrl4 T A 3: 151,500,201 D233E probably benign Het
Adgrv1 A T 13: 81,557,080 F1537Y probably damaging Het
Akap2 A G 4: 57,854,890 Y134C probably benign Het
Aqp3 T A 4: 41,098,061 I17F probably benign Het
Arap1 T A 7: 101,409,320 L1375H probably damaging Het
Aspm T C 1: 139,457,635 V339A probably benign Het
Atp13a3 G A 16: 30,354,276 A261V probably damaging Het
Casp8ap2 T C 4: 32,640,142 Y399H probably benign Het
Cept1 A G 3: 106,512,879 V213A probably damaging Het
Cit A G 5: 115,985,507 D1469G possibly damaging Het
Cnga2 A G X: 72,007,788 Y182C possibly damaging Het
Dhx8 C A 11: 101,738,409 D261E probably benign Het
Dnah2 A T 11: 69,458,185 I2486N probably benign Het
Dnah5 A G 15: 28,408,321 Q3484R probably benign Het
Drd1 T C 13: 54,053,553 Y207C probably damaging Het
Dtl C T 1: 191,558,110 V222I probably damaging Het
Dync1h1 T C 12: 110,640,882 Y2636H probably damaging Het
Endog C A 2: 30,172,036 D154E probably benign Het
Epc1 A T 18: 6,462,954 V14E probably damaging Het
Ercc4 C A 16: 13,147,934 T810K probably damaging Het
Fam43b T A 4: 138,395,988 N7I possibly damaging Het
Fgd1 T C X: 151,086,217 probably null Het
Filip1 G T 9: 79,819,330 T669N probably damaging Het
Fndc1 A G 17: 7,778,665 probably benign Het
Foxk1 C A 5: 142,435,188 S189* probably null Het
Gatm T C 2: 122,600,536 N274S probably damaging Het
Gdf9 A G 11: 53,437,507 Y430C probably damaging Het
Gga1 C T 15: 78,888,448 P260S probably damaging Het
Gm11595 A T 11: 99,772,501 C118S unknown Het
Gm382 G T X: 127,062,651 V820L possibly damaging Het
Gzmk T A 13: 113,172,014 I179F probably damaging Het
Hsp90b1 T C 10: 86,695,706 D421G probably damaging Het
Hus1 A G 11: 9,006,011 M174T probably damaging Het
Ifngr2 T A 16: 91,562,873 Y289* probably null Het
Il6st T A 13: 112,504,175 H828Q probably benign Het
Impg2 T A 16: 56,218,379 Y127N probably damaging Het
Irf3 T A 7: 45,001,744 W345R probably damaging Het
Kif1b G A 4: 149,187,640 S1568L possibly damaging Het
Klhl42 A G 6: 147,101,753 T342A probably benign Het
Kndc1 G T 7: 139,930,112 R1289L probably damaging Het
Knl1 A T 2: 119,071,819 T1334S possibly damaging Het
L3mbtl3 G T 10: 26,313,868 D499E unknown Het
Ldhd T A 8: 111,627,048 M478L probably benign Het
Loxl4 C G 19: 42,603,963 E385D probably damaging Het
Lrriq1 G A 10: 103,214,857 T678I probably benign Het
Macf1 T A 4: 123,492,774 I1017F probably benign Het
Madcam1 A G 10: 79,665,572 E157G possibly damaging Het
Mamdc4 T C 2: 25,569,258 D195G probably damaging Het
Mctp1 A G 13: 76,824,822 D648G probably damaging Het
Mycbp2 T C 14: 103,201,230 M2072V probably benign Het
Nck1 A G 9: 100,497,547 probably null Het
Ndufaf4 G T 4: 24,898,608 D55Y probably damaging Het
Nek11 A T 9: 105,300,361 D230E probably benign Het
Nit2 T C 16: 57,161,196 K67E possibly damaging Het
Olfr2 T C 7: 107,001,248 D204G probably damaging Het
Olfr290 T C 7: 84,916,493 F238S probably damaging Het
Olfr527 C T 7: 140,336,429 T189M probably damaging Het
Olfr802 A T 10: 129,682,532 V69E possibly damaging Het
Pccb G C 9: 100,985,831 D347E probably damaging Het
Plcl1 T A 1: 55,697,838 F779L probably damaging Het
Prune2 C A 19: 17,122,422 D1763E probably benign Het
Pwwp2a A G 11: 43,705,318 S437G probably benign Het
Rabgap1l A T 1: 160,738,957 D90E probably benign Het
Rapgef4 T A 2: 72,226,553 I552N possibly damaging Het
Scn7a A T 2: 66,697,986 I720K probably damaging Het
Scn9a T A 2: 66,526,654 N1101I probably damaging Het
Siglec1 A T 2: 131,080,497 Y553N probably damaging Het
Slc22a23 A G 13: 34,203,970 L381P possibly damaging Het
Slc7a11 T A 3: 50,384,109 T284S probably damaging Het
Slc8a2 T A 7: 16,140,492 probably null Het
Snx29 T A 16: 11,400,971 S224T probably damaging Het
Stox1 T C 10: 62,664,535 T749A probably benign Het
Tg A G 15: 66,694,894 I1264V probably benign Het
Tmem110 T C 14: 30,866,624 Y103H probably damaging Het
Top2a A C 11: 99,009,807 V609G probably damaging Het
Trmt44 G A 5: 35,574,832 P72S probably benign Het
Ttll3 G C 6: 113,412,934 S760T probably benign Het
Ttn T C 2: 76,748,678 D23957G probably damaging Het
Ttn G A 2: 76,833,897 probably benign Het
Ubxn1 T G 19: 8,872,070 V59G probably benign Het
Ubxn4 T C 1: 128,244,510 S14P probably benign Het
Uso1 T A 5: 92,195,370 M771K probably benign Het
Utp20 A G 10: 88,814,055 F431S probably damaging Het
Vmn1r206 T C 13: 22,620,612 S142G probably benign Het
Vmn2r19 A G 6: 123,308,330 probably null Het
Vps36 G T 8: 22,218,289 probably null Het
Wnt3 A G 11: 103,812,648 H319R possibly damaging Het
Zbtb26 G T 2: 37,436,551 Q158K probably benign Het
Zfp648 T C 1: 154,204,607 S171P probably benign Het
Other mutations in Cox20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02154:Cox20 APN 1 178322554 missense probably benign 0.01
IGL02318:Cox20 APN 1 178322478 splice site probably null
R4551:Cox20 UTSW 1 178322549 missense probably benign 0.15
R5344:Cox20 UTSW 1 178322033 unclassified probably benign
R6155:Cox20 UTSW 1 178321797 missense possibly damaging 0.67
R7653:Cox20 UTSW 1 178322599 missense probably benign 0.05
R7780:Cox20 UTSW 1 178322001 missense probably benign 0.20
R7840:Cox20 UTSW 1 178322561 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TAGCCCTTCAAGCTCCTAGG -3'
(R):5'- CAACTGGTGACTCATACCTTTAATCC -3'

Sequencing Primer
(F):5'- GCCCTTCAAGCTCCTAGGTATTTTAG -3'
(R):5'- GTGACTCATACCTTTAATCCCAGCAC -3'
Posted On2014-09-17