Incidental Mutation 'R2128:Dtl'
ID 227689
Institutional Source Beutler Lab
Gene Symbol Dtl
Ensembl Gene ENSMUSG00000037474
Gene Name denticleless E3 ubiquitin protein ligase
Synonyms 5730564G15Rik, 2810047L02Rik
MMRRC Submission 040131-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2128 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 191537356-191575544 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 191558110 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 222 (V222I)
Ref Sequence ENSEMBL: ENSMUSP00000027933 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027933] [ENSMUST00000193977] [ENSMUST00000195650]
AlphaFold Q3TLR7
Predicted Effect probably damaging
Transcript: ENSMUST00000027933
AA Change: V222I

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000027933
Gene: ENSMUSG00000037474
AA Change: V222I

DomainStartEndE-ValueType
Blast:WD40 30 80 1e-24 BLAST
WD40 87 126 2.61e-3 SMART
WD40 129 169 8.04e-4 SMART
WD40 205 244 8.29e-1 SMART
Blast:WD40 265 299 1e-11 BLAST
WD40 304 345 1.29e-2 SMART
WD40 349 389 1.07e-8 SMART
low complexity region 427 454 N/A INTRINSIC
low complexity region 476 495 N/A INTRINSIC
low complexity region 505 521 N/A INTRINSIC
low complexity region 630 645 N/A INTRINSIC
low complexity region 674 690 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193977
SMART Domains Protein: ENSMUSP00000142111
Gene: ENSMUSG00000037474

DomainStartEndE-ValueType
Blast:WD40 30 80 1e-26 BLAST
SCOP:d1e1aa_ 65 108 6e-5 SMART
Blast:WD40 87 113 6e-13 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194064
Predicted Effect probably benign
Transcript: ENSMUST00000195650
SMART Domains Protein: ENSMUSP00000141218
Gene: ENSMUSG00000037474

DomainStartEndE-ValueType
Blast:WD40 30 80 2e-26 BLAST
WD40 87 126 1.6e-5 SMART
Blast:WD40 129 154 7e-10 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195765
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mutation of this gene results in very early embryonic lethality around or before E1.5. In vitro siRNA knockdown experiments show that the gene is essential cell survival and cell cycle progression to allow proper blastocyst formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik A G 10: 87,230,204 (GRCm38) E249G possibly damaging Het
2610028H24Rik A G 10: 76,457,515 (GRCm38) M136V possibly damaging Het
4930523C07Rik A T 1: 160,075,375 (GRCm38) K72* probably null Het
Abca6 A G 11: 110,219,649 (GRCm38) I558T probably benign Het
Acot10 T C 15: 20,666,626 (GRCm38) T10A probably benign Het
Adgrl4 T A 3: 151,500,201 (GRCm38) D233E probably benign Het
Adgrv1 A T 13: 81,557,080 (GRCm38) F1537Y probably damaging Het
Akap2 A G 4: 57,854,890 (GRCm38) Y134C probably benign Het
Aqp3 T A 4: 41,098,061 (GRCm38) I17F probably benign Het
Arap1 T A 7: 101,409,320 (GRCm38) L1375H probably damaging Het
Aspm T C 1: 139,457,635 (GRCm38) V339A probably benign Het
Atp13a3 G A 16: 30,354,276 (GRCm38) A261V probably damaging Het
Casp8ap2 T C 4: 32,640,142 (GRCm38) Y399H probably benign Het
Cept1 A G 3: 106,512,879 (GRCm38) V213A probably damaging Het
Cit A G 5: 115,985,507 (GRCm38) D1469G possibly damaging Het
Cnga2 A G X: 72,007,788 (GRCm38) Y182C possibly damaging Het
Cox20 A G 1: 178,321,947 (GRCm38) I54V probably benign Het
Dhx8 C A 11: 101,738,409 (GRCm38) D261E probably benign Het
Dnah2 A T 11: 69,458,185 (GRCm38) I2486N probably benign Het
Dnah5 A G 15: 28,408,321 (GRCm38) Q3484R probably benign Het
Drd1 T C 13: 54,053,553 (GRCm38) Y207C probably damaging Het
Dync1h1 T C 12: 110,640,882 (GRCm38) Y2636H probably damaging Het
Endog C A 2: 30,172,036 (GRCm38) D154E probably benign Het
Epc1 A T 18: 6,462,954 (GRCm38) V14E probably damaging Het
Ercc4 C A 16: 13,147,934 (GRCm38) T810K probably damaging Het
Fam43b T A 4: 138,395,988 (GRCm38) N7I possibly damaging Het
Fgd1 T C X: 151,086,217 (GRCm38) probably null Het
Filip1 G T 9: 79,819,330 (GRCm38) T669N probably damaging Het
Fndc1 A G 17: 7,778,665 (GRCm38) probably benign Het
Foxk1 C A 5: 142,435,188 (GRCm38) S189* probably null Het
Gatm T C 2: 122,600,536 (GRCm38) N274S probably damaging Het
Gdf9 A G 11: 53,437,507 (GRCm38) Y430C probably damaging Het
Gga1 C T 15: 78,888,448 (GRCm38) P260S probably damaging Het
Gm11595 A T 11: 99,772,501 (GRCm38) C118S unknown Het
Gm382 G T X: 127,062,651 (GRCm38) V820L possibly damaging Het
Gzmk T A 13: 113,172,014 (GRCm38) I179F probably damaging Het
Hsp90b1 T C 10: 86,695,706 (GRCm38) D421G probably damaging Het
Hus1 A G 11: 9,006,011 (GRCm38) M174T probably damaging Het
Ifngr2 T A 16: 91,562,873 (GRCm38) Y289* probably null Het
Il6st T A 13: 112,504,175 (GRCm38) H828Q probably benign Het
Impg2 T A 16: 56,218,379 (GRCm38) Y127N probably damaging Het
Irf3 T A 7: 45,001,744 (GRCm38) W345R probably damaging Het
Kif1b G A 4: 149,187,640 (GRCm38) S1568L possibly damaging Het
Klhl42 A G 6: 147,101,753 (GRCm38) T342A probably benign Het
Kndc1 G T 7: 139,930,112 (GRCm38) R1289L probably damaging Het
Knl1 A T 2: 119,071,819 (GRCm38) T1334S possibly damaging Het
L3mbtl3 G T 10: 26,313,868 (GRCm38) D499E unknown Het
Ldhd T A 8: 111,627,048 (GRCm38) M478L probably benign Het
Loxl4 C G 19: 42,603,963 (GRCm38) E385D probably damaging Het
Lrriq1 G A 10: 103,214,857 (GRCm38) T678I probably benign Het
Macf1 T A 4: 123,492,774 (GRCm38) I1017F probably benign Het
Madcam1 A G 10: 79,665,572 (GRCm38) E157G possibly damaging Het
Mamdc4 T C 2: 25,569,258 (GRCm38) D195G probably damaging Het
Mctp1 A G 13: 76,824,822 (GRCm38) D648G probably damaging Het
Mycbp2 T C 14: 103,201,230 (GRCm38) M2072V probably benign Het
Nck1 A G 9: 100,497,547 (GRCm38) probably null Het
Ndufaf4 G T 4: 24,898,608 (GRCm38) D55Y probably damaging Het
Nek11 A T 9: 105,300,361 (GRCm38) D230E probably benign Het
Nit2 T C 16: 57,161,196 (GRCm38) K67E possibly damaging Het
Olfr2 T C 7: 107,001,248 (GRCm38) D204G probably damaging Het
Olfr290 T C 7: 84,916,493 (GRCm38) F238S probably damaging Het
Olfr527 C T 7: 140,336,429 (GRCm38) T189M probably damaging Het
Olfr802 A T 10: 129,682,532 (GRCm38) V69E possibly damaging Het
Pccb G C 9: 100,985,831 (GRCm38) D347E probably damaging Het
Plcl1 T A 1: 55,697,838 (GRCm38) F779L probably damaging Het
Prune2 C A 19: 17,122,422 (GRCm38) D1763E probably benign Het
Pwwp2a A G 11: 43,705,318 (GRCm38) S437G probably benign Het
Rabgap1l A T 1: 160,738,957 (GRCm38) D90E probably benign Het
Rapgef4 T A 2: 72,226,553 (GRCm38) I552N possibly damaging Het
Scn7a A T 2: 66,697,986 (GRCm38) I720K probably damaging Het
Scn9a T A 2: 66,526,654 (GRCm38) N1101I probably damaging Het
Siglec1 A T 2: 131,080,497 (GRCm38) Y553N probably damaging Het
Slc22a23 A G 13: 34,203,970 (GRCm38) L381P possibly damaging Het
Slc7a11 T A 3: 50,384,109 (GRCm38) T284S probably damaging Het
Slc8a2 T A 7: 16,140,492 (GRCm38) probably null Het
Snx29 T A 16: 11,400,971 (GRCm38) S224T probably damaging Het
Stox1 T C 10: 62,664,535 (GRCm38) T749A probably benign Het
Tg A G 15: 66,694,894 (GRCm38) I1264V probably benign Het
Tmem110 T C 14: 30,866,624 (GRCm38) Y103H probably damaging Het
Top2a A C 11: 99,009,807 (GRCm38) V609G probably damaging Het
Trmt44 G A 5: 35,574,832 (GRCm38) P72S probably benign Het
Ttll3 G C 6: 113,412,934 (GRCm38) S760T probably benign Het
Ttn T C 2: 76,748,678 (GRCm38) D23957G probably damaging Het
Ttn G A 2: 76,833,897 (GRCm38) probably benign Het
Ubxn1 T G 19: 8,872,070 (GRCm38) V59G probably benign Het
Ubxn4 T C 1: 128,244,510 (GRCm38) S14P probably benign Het
Uso1 T A 5: 92,195,370 (GRCm38) M771K probably benign Het
Utp20 A G 10: 88,814,055 (GRCm38) F431S probably damaging Het
Vmn1r206 T C 13: 22,620,612 (GRCm38) S142G probably benign Het
Vmn2r19 A G 6: 123,308,330 (GRCm38) probably null Het
Vps36 G T 8: 22,218,289 (GRCm38) probably null Het
Wnt3 A G 11: 103,812,648 (GRCm38) H319R possibly damaging Het
Zbtb26 G T 2: 37,436,551 (GRCm38) Q158K probably benign Het
Zfp648 T C 1: 154,204,607 (GRCm38) S171P probably benign Het
Other mutations in Dtl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00678:Dtl APN 1 191,546,626 (GRCm38) splice site probably null
IGL01069:Dtl APN 1 191,561,539 (GRCm38) critical splice acceptor site probably null
IGL01135:Dtl APN 1 191,548,330 (GRCm38) missense probably damaging 1.00
IGL01307:Dtl APN 1 191,570,699 (GRCm38) missense possibly damaging 0.78
IGL01461:Dtl APN 1 191,546,617 (GRCm38) missense possibly damaging 0.88
IGL01809:Dtl APN 1 191,548,303 (GRCm38) missense probably damaging 1.00
IGL01958:Dtl APN 1 191,568,377 (GRCm38) missense probably damaging 1.00
IGL02217:Dtl APN 1 191,568,314 (GRCm38) missense probably damaging 1.00
IGL02408:Dtl APN 1 191,541,240 (GRCm38) missense probably benign 0.00
IGL02445:Dtl APN 1 191,558,060 (GRCm38) critical splice donor site probably null
IGL02661:Dtl APN 1 191,541,371 (GRCm38) missense probably benign 0.09
IGL02864:Dtl APN 1 191,556,826 (GRCm38) missense probably benign 0.04
IGL02897:Dtl APN 1 191,541,544 (GRCm38) splice site probably benign
IGL03069:Dtl APN 1 191,556,896 (GRCm38) splice site probably benign
PIT4418001:Dtl UTSW 1 191,541,317 (GRCm38) missense possibly damaging 0.46
R0370:Dtl UTSW 1 191,575,350 (GRCm38) missense probably benign 0.05
R0513:Dtl UTSW 1 191,569,707 (GRCm38) nonsense probably null
R1386:Dtl UTSW 1 191,569,717 (GRCm38) missense probably damaging 1.00
R1424:Dtl UTSW 1 191,561,537 (GRCm38) missense probably benign 0.13
R1575:Dtl UTSW 1 191,561,546 (GRCm38) splice site probably null
R2297:Dtl UTSW 1 191,541,095 (GRCm38) missense probably benign 0.41
R2344:Dtl UTSW 1 191,548,378 (GRCm38) missense probably benign 0.00
R3121:Dtl UTSW 1 191,553,063 (GRCm38) nonsense probably null
R3808:Dtl UTSW 1 191,548,354 (GRCm38) missense probably damaging 1.00
R4722:Dtl UTSW 1 191,556,841 (GRCm38) missense possibly damaging 0.52
R4753:Dtl UTSW 1 191,569,703 (GRCm38) missense probably damaging 1.00
R4904:Dtl UTSW 1 191,568,345 (GRCm38) missense probably damaging 0.99
R4965:Dtl UTSW 1 191,546,565 (GRCm38) missense possibly damaging 0.93
R5068:Dtl UTSW 1 191,568,373 (GRCm38) missense probably damaging 1.00
R5119:Dtl UTSW 1 191,541,506 (GRCm38) missense probably damaging 1.00
R5872:Dtl UTSW 1 191,546,568 (GRCm38) missense probably benign 0.00
R5911:Dtl UTSW 1 191,568,407 (GRCm38) missense probably damaging 1.00
R5992:Dtl UTSW 1 191,568,572 (GRCm38) splice site probably null
R6425:Dtl UTSW 1 191,546,623 (GRCm38) missense probably benign 0.02
R7403:Dtl UTSW 1 191,563,173 (GRCm38) missense probably damaging 1.00
R8756:Dtl UTSW 1 191,539,259 (GRCm38) missense probably benign
R8835:Dtl UTSW 1 191,561,497 (GRCm38) missense probably damaging 1.00
R8850:Dtl UTSW 1 191,553,063 (GRCm38) nonsense probably null
R9091:Dtl UTSW 1 191,556,811 (GRCm38) missense probably damaging 1.00
R9270:Dtl UTSW 1 191,556,811 (GRCm38) missense probably damaging 1.00
X0018:Dtl UTSW 1 191,568,410 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTCCAGTGTGACCTGTAAACTTC -3'
(R):5'- AAGTGTACTGCTTCGGGTC -3'

Sequencing Primer
(F):5'- AGTGTGACCTGTAAACTTCTTCCCAG -3'
(R):5'- TCTAGGCAGCCATATTGTTAGG -3'
Posted On 2014-09-17