Incidental Mutation 'R0152:Pdhx'
ID22769
Institutional Source Beutler Lab
Gene Symbol Pdhx
Ensembl Gene ENSMUSG00000010914
Gene Namepyruvate dehydrogenase complex, component X
SynonymsPdx1
MMRRC Submission 038435-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0152 (G1)
Quality Score225
Status Validated (trace)
Chromosome2
Chromosomal Location103021075-103073513 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 103028280 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 393 (V393A)
Ref Sequence ENSEMBL: ENSMUSP00000011058 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011058] [ENSMUST00000132449]
Predicted Effect probably benign
Transcript: ENSMUST00000011058
AA Change: V393A

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000011058
Gene: ENSMUSG00000010914
AA Change: V393A

DomainStartEndE-ValueType
low complexity region 13 28 N/A INTRINSIC
Pfam:Biotin_lipoyl 57 131 1.3e-21 PFAM
low complexity region 148 172 N/A INTRINSIC
Pfam:E3_binding 182 217 5e-9 PFAM
low complexity region 233 249 N/A INTRINSIC
Pfam:2-oxoacid_dh 272 501 8.4e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132449
SMART Domains Protein: ENSMUSP00000119172
Gene: ENSMUSG00000010914

DomainStartEndE-ValueType
Pfam:Biotin_lipoyl 5 66 1.3e-14 PFAM
low complexity region 83 107 N/A INTRINSIC
Pfam:E3_binding 115 153 6.1e-14 PFAM
low complexity region 168 184 N/A INTRINSIC
Meta Mutation Damage Score 0.1302 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.3%
  • 20x: 89.5%
Validation Efficiency 87% (40/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The pyruvate dehydrogenase (PDH) complex is located in the mitochondrial matrix and catalyzes the conversion of pyruvate to acetyl coenzyme A. The PDH complex thereby links glycolysis to Krebs cycle. The PDH complex contains three catalytic subunits, E1, E2, and E3, two regulatory subunits, E1 kinase and E1 phosphatase, and a non-catalytic subunit, E3 binding protein (E3BP). This gene encodes the E3 binding protein subunit; also known as component X of the pyruvate dehydrogenase complex. This protein tethers E3 dimers to the E2 core of the PDH complex. Defects in this gene are a cause of pyruvate dehydrogenase deficiency which results in neurological dysfunction and lactic acidosis in infancy and early childhood. This protein is also a minor antigen for antimitochondrial antibodies. These autoantibodies are present in nearly 95% of patients with the autoimmune liver disease primary biliary cirrhosis (PBC). In PBC, activated T lymphocytes attack and destroy epithelial cells in the bile duct where this protein is abnormally distributed and overexpressed. PBC eventually leads to cirrhosis and liver failure. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass T C 6: 23,074,689 D834G probably damaging Het
Abca13 T A 11: 9,581,724 H4650Q probably damaging Het
Aqr T A 2: 114,159,010 T111S probably benign Het
Arfip2 G A 7: 105,637,223 T124M probably damaging Het
Arhgap44 G T 11: 65,011,919 A574E probably benign Het
Arhgef26 T C 3: 62,423,544 S560P probably damaging Het
Car5a T A 8: 121,916,446 N273I probably damaging Het
Cd4 G A 6: 124,867,746 Q359* probably null Het
Cgrrf1 G A 14: 46,853,913 C298Y probably damaging Het
Clip3 G A 7: 30,303,432 A416T probably benign Het
Dst C T 1: 34,189,119 P1606L probably damaging Het
Eif3e G A 15: 43,252,236 A378V possibly damaging Het
Ercc6 C G 14: 32,546,905 probably benign Het
Eri2 A G 7: 119,790,383 V104A probably damaging Het
Exph5 T A 9: 53,353,204 probably null Het
Hmcn1 A T 1: 150,663,879 Y2954N probably benign Het
Itga2 C T 13: 114,866,314 G547R probably benign Het
Kbtbd11 T C 8: 15,027,428 V9A probably damaging Het
Ldb2 T C 5: 44,541,799 D99G possibly damaging Het
Mfsd12 G T 10: 81,357,799 D68Y probably damaging Het
Mgarp T C 3: 51,388,963 D228G probably benign Het
Myh14 A T 7: 44,623,181 L1441Q probably damaging Het
Obscn T C 11: 59,052,576 D4810G probably benign Het
Olfr1331 T A 4: 118,868,886 I34N possibly damaging Het
Olfr1448 A G 19: 12,920,108 V67A possibly damaging Het
Olfr293 A T 7: 86,664,511 Y283F probably damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr948 A G 9: 39,319,461 I51T probably benign Het
Pdpk1 C T 17: 24,106,946 R92H possibly damaging Het
Pgr A T 9: 8,965,022 I889F probably benign Het
Pum2 T A 12: 8,728,754 I468K possibly damaging Het
Recql5 A G 11: 115,894,673 S666P probably benign Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc26a4 T C 12: 31,529,498 I588M probably damaging Het
Slc9a2 A G 1: 40,742,804 T398A probably damaging Het
Snapc1 C T 12: 73,975,032 R81C probably damaging Het
Tub A T 7: 109,020,927 N93Y probably damaging Het
Usp3 T C 9: 66,540,150 T181A probably damaging Het
Vars2 A G 17: 35,660,027 L637P probably damaging Het
Vmn2r1 T C 3: 64,081,819 S60P possibly damaging Het
Wdcp A G 12: 4,851,583 S480G probably benign Het
Zbtb38 T C 9: 96,686,280 Y917C probably damaging Het
Zfp68 T C 5: 138,606,613 K445E probably damaging Het
Zmynd10 A G 9: 107,550,945 probably null Het
Other mutations in Pdhx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02147:Pdhx APN 2 103030341 unclassified probably benign
IGL02450:Pdhx APN 2 103042249 missense probably benign 0.00
R0317:Pdhx UTSW 2 103028280 missense probably benign 0.04
R2351:Pdhx UTSW 2 103024217 nonsense probably null
R3937:Pdhx UTSW 2 103022219 missense probably damaging 1.00
R3950:Pdhx UTSW 2 103035241 missense probably damaging 0.99
R4546:Pdhx UTSW 2 103073397 missense probably null 0.99
R4677:Pdhx UTSW 2 103073466 splice site probably null
R4744:Pdhx UTSW 2 103042296 missense probably benign 0.01
R4996:Pdhx UTSW 2 103030312 missense probably damaging 1.00
R5000:Pdhx UTSW 2 103041040 splice site probably null
R5076:Pdhx UTSW 2 103041077 missense probably damaging 0.99
R5682:Pdhx UTSW 2 103035340 missense probably benign 0.00
R6246:Pdhx UTSW 2 103046792 missense probably damaging 1.00
R6850:Pdhx UTSW 2 103041100 missense probably damaging 1.00
R7141:Pdhx UTSW 2 103073314 missense probably benign 0.21
R7219:Pdhx UTSW 2 103028415 missense probably benign 0.01
R7460:Pdhx UTSW 2 103046779 missense probably damaging 1.00
R7552:Pdhx UTSW 2 103046754 missense probably benign 0.01
R8325:Pdhx UTSW 2 103042252 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TGCCCAGAACATGAATGAAGCTGAC -3'
(R):5'- AGGCTGCTTCCTTCATAGCATGTC -3'

Sequencing Primer
(F):5'- GAAGCTGACCTCTAATTTACATGC -3'
(R):5'- ATGTCTTTTCCTGCTTACAGCAAATG -3'
Posted On2013-04-16