Incidental Mutation 'R2128:Slc7a11'
ID227701
Institutional Source Beutler Lab
Gene Symbol Slc7a11
Ensembl Gene ENSMUSG00000027737
Gene Namesolute carrier family 7 (cationic amino acid transporter, y+ system), member 11
Synonymssut, System x, x, 9930009M05Rik, xCT
MMRRC Submission 040131-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2128 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location49892526-50443614 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 50384109 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 284 (T284S)
Ref Sequence ENSEMBL: ENSMUSP00000029297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029297] [ENSMUST00000194462]
Predicted Effect probably damaging
Transcript: ENSMUST00000029297
AA Change: T284S

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000029297
Gene: ENSMUSG00000027737
AA Change: T284S

DomainStartEndE-ValueType
Pfam:AA_permease_2 44 469 3.3e-61 PFAM
Pfam:AA_permease 49 478 1.1e-33 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000194462
AA Change: T284S

PolyPhen 2 Score 0.812 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000141988
Gene: ENSMUSG00000027737
AA Change: T284S

DomainStartEndE-ValueType
Pfam:AA_permease_2 44 469 1.1e-60 PFAM
Pfam:AA_permease 49 479 2e-32 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a heteromeric, sodium-independent, anionic amino acid transport system that is highly specific for cysteine and glutamate. In this system, designated Xc(-), the anionic form of cysteine is transported in exchange for glutamate. This protein has been identified as the predominant mediator of Kaposi sarcoma-associated herpesvirus fusion and entry permissiveness into cells. Also, increased expression of this gene in primary gliomas (compared to normal brain tissue) was associated with increased glutamate secretion via the XCT channels, resulting in neuronal cell death. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous mutant mice show a reduction in yellow pigment resulting in dilution of agouti; only pinna hairs are affected in nonagouti mice. Mice homozygous for an ENU-induced allele exhibit decreased survival of LPS-induced macrophages and increased incidence of chemically-induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik A G 10: 87,230,204 E249G possibly damaging Het
2610028H24Rik A G 10: 76,457,515 M136V possibly damaging Het
4930523C07Rik A T 1: 160,075,375 K72* probably null Het
Abca6 A G 11: 110,219,649 I558T probably benign Het
Acot10 T C 15: 20,666,626 T10A probably benign Het
Adgrl4 T A 3: 151,500,201 D233E probably benign Het
Adgrv1 A T 13: 81,557,080 F1537Y probably damaging Het
Akap2 A G 4: 57,854,890 Y134C probably benign Het
Aqp3 T A 4: 41,098,061 I17F probably benign Het
Arap1 T A 7: 101,409,320 L1375H probably damaging Het
Aspm T C 1: 139,457,635 V339A probably benign Het
Atp13a3 G A 16: 30,354,276 A261V probably damaging Het
Casp8ap2 T C 4: 32,640,142 Y399H probably benign Het
Cept1 A G 3: 106,512,879 V213A probably damaging Het
Cit A G 5: 115,985,507 D1469G possibly damaging Het
Cnga2 A G X: 72,007,788 Y182C possibly damaging Het
Cox20 A G 1: 178,321,947 I54V probably benign Het
Dhx8 C A 11: 101,738,409 D261E probably benign Het
Dnah2 A T 11: 69,458,185 I2486N probably benign Het
Dnah5 A G 15: 28,408,321 Q3484R probably benign Het
Drd1 T C 13: 54,053,553 Y207C probably damaging Het
Dtl C T 1: 191,558,110 V222I probably damaging Het
Dync1h1 T C 12: 110,640,882 Y2636H probably damaging Het
Endog C A 2: 30,172,036 D154E probably benign Het
Epc1 A T 18: 6,462,954 V14E probably damaging Het
Ercc4 C A 16: 13,147,934 T810K probably damaging Het
Fam43b T A 4: 138,395,988 N7I possibly damaging Het
Fgd1 T C X: 151,086,217 probably null Het
Filip1 G T 9: 79,819,330 T669N probably damaging Het
Fndc1 A G 17: 7,778,665 probably benign Het
Foxk1 C A 5: 142,435,188 S189* probably null Het
Gatm T C 2: 122,600,536 N274S probably damaging Het
Gdf9 A G 11: 53,437,507 Y430C probably damaging Het
Gga1 C T 15: 78,888,448 P260S probably damaging Het
Gm11595 A T 11: 99,772,501 C118S unknown Het
Gm382 G T X: 127,062,651 V820L possibly damaging Het
Gzmk T A 13: 113,172,014 I179F probably damaging Het
Hsp90b1 T C 10: 86,695,706 D421G probably damaging Het
Hus1 A G 11: 9,006,011 M174T probably damaging Het
Ifngr2 T A 16: 91,562,873 Y289* probably null Het
Il6st T A 13: 112,504,175 H828Q probably benign Het
Impg2 T A 16: 56,218,379 Y127N probably damaging Het
Irf3 T A 7: 45,001,744 W345R probably damaging Het
Kif1b G A 4: 149,187,640 S1568L possibly damaging Het
Klhl42 A G 6: 147,101,753 T342A probably benign Het
Kndc1 G T 7: 139,930,112 R1289L probably damaging Het
Knl1 A T 2: 119,071,819 T1334S possibly damaging Het
L3mbtl3 G T 10: 26,313,868 D499E unknown Het
Ldhd T A 8: 111,627,048 M478L probably benign Het
Loxl4 C G 19: 42,603,963 E385D probably damaging Het
Lrriq1 G A 10: 103,214,857 T678I probably benign Het
Macf1 T A 4: 123,492,774 I1017F probably benign Het
Madcam1 A G 10: 79,665,572 E157G possibly damaging Het
Mamdc4 T C 2: 25,569,258 D195G probably damaging Het
Mctp1 A G 13: 76,824,822 D648G probably damaging Het
Mycbp2 T C 14: 103,201,230 M2072V probably benign Het
Nck1 A G 9: 100,497,547 probably null Het
Ndufaf4 G T 4: 24,898,608 D55Y probably damaging Het
Nek11 A T 9: 105,300,361 D230E probably benign Het
Nit2 T C 16: 57,161,196 K67E possibly damaging Het
Olfr2 T C 7: 107,001,248 D204G probably damaging Het
Olfr290 T C 7: 84,916,493 F238S probably damaging Het
Olfr527 C T 7: 140,336,429 T189M probably damaging Het
Olfr802 A T 10: 129,682,532 V69E possibly damaging Het
Pccb G C 9: 100,985,831 D347E probably damaging Het
Plcl1 T A 1: 55,697,838 F779L probably damaging Het
Prune2 C A 19: 17,122,422 D1763E probably benign Het
Pwwp2a A G 11: 43,705,318 S437G probably benign Het
Rabgap1l A T 1: 160,738,957 D90E probably benign Het
Rapgef4 T A 2: 72,226,553 I552N possibly damaging Het
Scn7a A T 2: 66,697,986 I720K probably damaging Het
Scn9a T A 2: 66,526,654 N1101I probably damaging Het
Siglec1 A T 2: 131,080,497 Y553N probably damaging Het
Slc22a23 A G 13: 34,203,970 L381P possibly damaging Het
Slc8a2 T A 7: 16,140,492 probably null Het
Snx29 T A 16: 11,400,971 S224T probably damaging Het
Stox1 T C 10: 62,664,535 T749A probably benign Het
Tg A G 15: 66,694,894 I1264V probably benign Het
Tmem110 T C 14: 30,866,624 Y103H probably damaging Het
Top2a A C 11: 99,009,807 V609G probably damaging Het
Trmt44 G A 5: 35,574,832 P72S probably benign Het
Ttll3 G C 6: 113,412,934 S760T probably benign Het
Ttn T C 2: 76,748,678 D23957G probably damaging Het
Ttn G A 2: 76,833,897 probably benign Het
Ubxn1 T G 19: 8,872,070 V59G probably benign Het
Ubxn4 T C 1: 128,244,510 S14P probably benign Het
Uso1 T A 5: 92,195,370 M771K probably benign Het
Utp20 A G 10: 88,814,055 F431S probably damaging Het
Vmn1r206 T C 13: 22,620,612 S142G probably benign Het
Vmn2r19 A G 6: 123,308,330 probably null Het
Vps36 G T 8: 22,218,289 probably null Het
Wnt3 A G 11: 103,812,648 H319R possibly damaging Het
Zbtb26 G T 2: 37,436,551 Q158K probably benign Het
Zfp648 T C 1: 154,204,607 S171P probably benign Het
Other mutations in Slc7a11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00660:Slc7a11 APN 3 50427687 missense probably benign 0.06
IGL00990:Slc7a11 APN 3 50379069 missense probably damaging 1.00
IGL01755:Slc7a11 APN 3 50424067 missense probably benign 0.39
IGL03105:Slc7a11 APN 3 50372339 missense possibly damaging 0.67
IGL03141:Slc7a11 APN 3 50381885 missense possibly damaging 0.66
R0468:Slc7a11 UTSW 3 50384051 missense probably damaging 1.00
R0735:Slc7a11 UTSW 3 50424096 missense probably benign 0.00
R1363:Slc7a11 UTSW 3 50424051 missense probably damaging 1.00
R1466:Slc7a11 UTSW 3 50381073 splice site probably null
R1466:Slc7a11 UTSW 3 50381073 splice site probably null
R1554:Slc7a11 UTSW 3 50381896 missense probably damaging 1.00
R1734:Slc7a11 UTSW 3 50372346 nonsense probably null
R2504:Slc7a11 UTSW 3 50377746 splice site probably null
R3116:Slc7a11 UTSW 3 50384139 missense probably benign 0.13
R3981:Slc7a11 UTSW 3 50427774 missense probably benign
R4479:Slc7a11 UTSW 3 50417963 intron probably benign
R5117:Slc7a11 UTSW 3 50379150 missense probably damaging 0.99
R5586:Slc7a11 UTSW 3 50443083 missense possibly damaging 0.95
R5621:Slc7a11 UTSW 3 50438875 missense probably damaging 1.00
R5689:Slc7a11 UTSW 3 50372331 missense probably benign 0.01
R5692:Slc7a11 UTSW 3 50372331 missense probably benign 0.01
R5965:Slc7a11 UTSW 3 50379144 missense probably benign 0.00
R6338:Slc7a11 UTSW 3 50384043 critical splice donor site probably null
R7177:Slc7a11 UTSW 3 50443231 missense probably benign 0.00
R7337:Slc7a11 UTSW 3 50442999 missense possibly damaging 0.50
R7634:Slc7a11 UTSW 3 50424037 splice site probably null
R7756:Slc7a11 UTSW 3 50372360 missense probably benign
R7758:Slc7a11 UTSW 3 50372360 missense probably benign
R7821:Slc7a11 UTSW 3 50381027 missense probably damaging 1.00
R8112:Slc7a11 UTSW 3 50417991 missense possibly damaging 0.92
R8218:Slc7a11 UTSW 3 50424052 missense probably damaging 1.00
R8255:Slc7a11 UTSW 3 50427728 missense probably damaging 0.98
R8318:Slc7a11 UTSW 3 50417986 critical splice donor site probably null
R8396:Slc7a11 UTSW 3 50384129 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- TCTCCTGGAAGAAACCACGATC -3'
(R):5'- TGCAAGGGTACTCTGTTCTG -3'

Sequencing Primer
(F):5'- GATCAAACTGTACCAGCTCATTAAC -3'
(R):5'- TGTTCCTCCATGTGCCAACAAAG -3'
Posted On2014-09-17