Mutagenetix > Incidental Mutations

Incidental Mutation 'R2128:Casp8ap2'

227705

Institutional Source

Beutler Lab

Gene Symbol

Casp8ap2

Ensembl Gene

ENSMUSG00000028282

Gene Name

caspase 8 associated protein 2

Synonyms

FLASH, D4Ertd659e

MMRRC Submission

040131-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2128 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

32615451-32653265 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 32640142 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 399 (Y399H)

Ref Sequence

ENSEMBL: ENSMUSP00000136016 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029950] [ENSMUST00000108178] [ENSMUST00000178925]

AlphaFold

Q9WUF3

Predicted Effect

probably benign
Transcript: ENSMUST00000029950
AA Change: Y399H

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000029950
Gene: ENSMUSG00000028282
AA Change: Y399H

Domain	Start	End	E-Value	Type
coiled coil region	68	142	N/A	INTRINSIC
low complexity region	292	303	N/A	INTRINSIC
low complexity region	458	477	N/A	INTRINSIC
low complexity region	1124	1135	N/A	INTRINSIC
low complexity region	1250	1268	N/A	INTRINSIC
low complexity region	1360	1377	N/A	INTRINSIC
low complexity region	1458	1470	N/A	INTRINSIC
low complexity region	1477	1498	N/A	INTRINSIC
low complexity region	1882	1895	N/A	INTRINSIC
PDB:2LR8\|A	1896	1962	1e-31	PDB
Blast:SANT	1905	1955	2e-21	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000108178

SMART Domains

Protein: ENSMUSP00000103813
Gene: ENSMUSG00000028282

Domain	Start	End	E-Value	Type
PDB:2LR8\|A	126	190	4e-26	PDB
Blast:SANT	139	183	4e-19	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127619

Predicted Effect

probably benign
Transcript: ENSMUST00000178925
AA Change: Y399H

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000136016
Gene: ENSMUSG00000028282
AA Change: Y399H

Domain	Start	End	E-Value	Type
coiled coil region	68	142	N/A	INTRINSIC
low complexity region	292	303	N/A	INTRINSIC
low complexity region	458	477	N/A	INTRINSIC
low complexity region	1124	1135	N/A	INTRINSIC
low complexity region	1250	1268	N/A	INTRINSIC
low complexity region	1360	1377	N/A	INTRINSIC
low complexity region	1458	1470	N/A	INTRINSIC
low complexity region	1477	1498	N/A	INTRINSIC
low complexity region	1882	1895	N/A	INTRINSIC
PDB:2LR8\|A	1896	1962	1e-31	PDB
Blast:SANT	1905	1955	2e-21	BLAST

Meta Mutation Damage Score

0.0597

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein is highly similar to FLASH, a mouse apoptotic protein identified by its interaction with the death-effector domain (DED) of caspase 8. Studies of FLASH protein suggested that this protein may be a component of the death-inducing signaling complex that includes Fas receptor, Fas-binding adapter FADD, and caspase 8, and plays a regulatory role in Fas-mediated apoptosis. Alternative splicing results in multiple transcript variants encoding the same protein.[provided by RefSeq, Nov 2008]
PHENOTYPE: Mice homozygous for disruption of this gene die before implantation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 94 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700113H08Rik	A	G	10: 87,230,204	E249G	possibly damaging	Het
2610028H24Rik	A	G	10: 76,457,515	M136V	possibly damaging	Het
4930523C07Rik	A	T	1: 160,075,375	K72*	probably null	Het
Abca6	A	G	11: 110,219,649	I558T	probably benign	Het
Acot10	T	C	15: 20,666,626	T10A	probably benign	Het
Adgrl4	T	A	3: 151,500,201	D233E	probably benign	Het
Adgrv1	A	T	13: 81,557,080	F1537Y	probably damaging	Het
Akap2	A	G	4: 57,854,890	Y134C	probably benign	Het
Aqp3	T	A	4: 41,098,061	I17F	probably benign	Het
Arap1	T	A	7: 101,409,320	L1375H	probably damaging	Het
Aspm	T	C	1: 139,457,635	V339A	probably benign	Het
Atp13a3	G	A	16: 30,354,276	A261V	probably damaging	Het
Cept1	A	G	3: 106,512,879	V213A	probably damaging	Het
Cit	A	G	5: 115,985,507	D1469G	possibly damaging	Het
Cnga2	A	G	X: 72,007,788	Y182C	possibly damaging	Het
Cox20	A	G	1: 178,321,947	I54V	probably benign	Het
Dhx8	C	A	11: 101,738,409	D261E	probably benign	Het
Dnah2	A	T	11: 69,458,185	I2486N	probably benign	Het
Dnah5	A	G	15: 28,408,321	Q3484R	probably benign	Het
Drd1	T	C	13: 54,053,553	Y207C	probably damaging	Het
Dtl	C	T	1: 191,558,110	V222I	probably damaging	Het
Dync1h1	T	C	12: 110,640,882	Y2636H	probably damaging	Het
Endog	C	A	2: 30,172,036	D154E	probably benign	Het
Epc1	A	T	18: 6,462,954	V14E	probably damaging	Het
Ercc4	C	A	16: 13,147,934	T810K	probably damaging	Het
Fam43b	T	A	4: 138,395,988	N7I	possibly damaging	Het
Fgd1	T	C	X: 151,086,217		probably null	Het
Filip1	G	T	9: 79,819,330	T669N	probably damaging	Het
Fndc1	A	G	17: 7,778,665		probably benign	Het
Foxk1	C	A	5: 142,435,188	S189*	probably null	Het
Gatm	T	C	2: 122,600,536	N274S	probably damaging	Het
Gdf9	A	G	11: 53,437,507	Y430C	probably damaging	Het
Gga1	C	T	15: 78,888,448	P260S	probably damaging	Het
Gm11595	A	T	11: 99,772,501	C118S	unknown	Het
Gm382	G	T	X: 127,062,651	V820L	possibly damaging	Het
Gzmk	T	A	13: 113,172,014	I179F	probably damaging	Het
Hsp90b1	T	C	10: 86,695,706	D421G	probably damaging	Het
Hus1	A	G	11: 9,006,011	M174T	probably damaging	Het
Ifngr2	T	A	16: 91,562,873	Y289*	probably null	Het
Il6st	T	A	13: 112,504,175	H828Q	probably benign	Het
Impg2	T	A	16: 56,218,379	Y127N	probably damaging	Het
Irf3	T	A	7: 45,001,744	W345R	probably damaging	Het
Kif1b	G	A	4: 149,187,640	S1568L	possibly damaging	Het
Klhl42	A	G	6: 147,101,753	T342A	probably benign	Het
Kndc1	G	T	7: 139,930,112	R1289L	probably damaging	Het
Knl1	A	T	2: 119,071,819	T1334S	possibly damaging	Het
L3mbtl3	G	T	10: 26,313,868	D499E	unknown	Het
Ldhd	T	A	8: 111,627,048	M478L	probably benign	Het
Loxl4	C	G	19: 42,603,963	E385D	probably damaging	Het
Lrriq1	G	A	10: 103,214,857	T678I	probably benign	Het
Macf1	T	A	4: 123,492,774	I1017F	probably benign	Het
Madcam1	A	G	10: 79,665,572	E157G	possibly damaging	Het
Mamdc4	T	C	2: 25,569,258	D195G	probably damaging	Het
Mctp1	A	G	13: 76,824,822	D648G	probably damaging	Het
Mycbp2	T	C	14: 103,201,230	M2072V	probably benign	Het
Nck1	A	G	9: 100,497,547		probably null	Het
Ndufaf4	G	T	4: 24,898,608	D55Y	probably damaging	Het
Nek11	A	T	9: 105,300,361	D230E	probably benign	Het
Nit2	T	C	16: 57,161,196	K67E	possibly damaging	Het
Olfr2	T	C	7: 107,001,248	D204G	probably damaging	Het
Olfr290	T	C	7: 84,916,493	F238S	probably damaging	Het
Olfr527	C	T	7: 140,336,429	T189M	probably damaging	Het
Olfr802	A	T	10: 129,682,532	V69E	possibly damaging	Het
Pccb	G	C	9: 100,985,831	D347E	probably damaging	Het
Plcl1	T	A	1: 55,697,838	F779L	probably damaging	Het
Prune2	C	A	19: 17,122,422	D1763E	probably benign	Het
Pwwp2a	A	G	11: 43,705,318	S437G	probably benign	Het
Rabgap1l	A	T	1: 160,738,957	D90E	probably benign	Het
Rapgef4	T	A	2: 72,226,553	I552N	possibly damaging	Het
Scn7a	A	T	2: 66,697,986	I720K	probably damaging	Het
Scn9a	T	A	2: 66,526,654	N1101I	probably damaging	Het
Siglec1	A	T	2: 131,080,497	Y553N	probably damaging	Het
Slc22a23	A	G	13: 34,203,970	L381P	possibly damaging	Het
Slc7a11	T	A	3: 50,384,109	T284S	probably damaging	Het
Slc8a2	T	A	7: 16,140,492		probably null	Het
Snx29	T	A	16: 11,400,971	S224T	probably damaging	Het
Stox1	T	C	10: 62,664,535	T749A	probably benign	Het
Tg	A	G	15: 66,694,894	I1264V	probably benign	Het
Tmem110	T	C	14: 30,866,624	Y103H	probably damaging	Het
Top2a	A	C	11: 99,009,807	V609G	probably damaging	Het
Trmt44	G	A	5: 35,574,832	P72S	probably benign	Het
Ttll3	G	C	6: 113,412,934	S760T	probably benign	Het
Ttn	T	C	2: 76,748,678	D23957G	probably damaging	Het
Ttn	G	A	2: 76,833,897		probably benign	Het
Ubxn1	T	G	19: 8,872,070	V59G	probably benign	Het
Ubxn4	T	C	1: 128,244,510	S14P	probably benign	Het
Uso1	T	A	5: 92,195,370	M771K	probably benign	Het
Utp20	A	G	10: 88,814,055	F431S	probably damaging	Het
Vmn1r206	T	C	13: 22,620,612	S142G	probably benign	Het
Vmn2r19	A	G	6: 123,308,330		probably null	Het
Vps36	G	T	8: 22,218,289		probably null	Het
Wnt3	A	G	11: 103,812,648	H319R	possibly damaging	Het
Zbtb26	G	T	2: 37,436,551	Q158K	probably benign	Het
Zfp648	T	C	1: 154,204,607	S171P	probably benign	Het

Other mutations in Casp8ap2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00686:Casp8ap2	APN	4	32641433	missense	probably damaging	1.00
IGL00714:Casp8ap2	APN	4	32649192	missense	probably damaging	1.00
IGL00754:Casp8ap2	APN	4	32641036	missense	probably benign	0.00
IGL00954:Casp8ap2	APN	4	32645403	missense	probably damaging	1.00
IGL00970:Casp8ap2	APN	4	32646182	missense	probably benign
IGL01534:Casp8ap2	APN	4	32648134	splice site	probably benign
IGL01596:Casp8ap2	APN	4	32646365	missense	probably damaging	1.00
IGL01686:Casp8ap2	APN	4	32641294	missense	possibly damaging	0.94
IGL02002:Casp8ap2	APN	4	32639391	missense	probably damaging	1.00
IGL02273:Casp8ap2	APN	4	32643974	missense	probably damaging	1.00
IGL02510:Casp8ap2	APN	4	32639704	missense	probably benign	0.05
IGL02600:Casp8ap2	APN	4	32630246	missense	probably null	1.00
IGL02929:Casp8ap2	APN	4	32624105	utr 5 prime	probably benign
F5770:Casp8ap2	UTSW	4	32639944	missense	probably benign	0.00
IGL02988:Casp8ap2	UTSW	4	32644590	missense	probably benign	0.14
R0023:Casp8ap2	UTSW	4	32640185	missense	probably damaging	0.99
R0027:Casp8ap2	UTSW	4	32643810	missense	probably benign	0.01
R0090:Casp8ap2	UTSW	4	32640327	missense	probably damaging	1.00
R0117:Casp8ap2	UTSW	4	32640817	missense	probably benign	0.00
R0144:Casp8ap2	UTSW	4	32643797	missense	possibly damaging	0.50
R0268:Casp8ap2	UTSW	4	32644079	missense	probably damaging	0.99
R0344:Casp8ap2	UTSW	4	32644079	missense	probably damaging	0.99
R0555:Casp8ap2	UTSW	4	32640381	missense	probably damaging	1.00
R1051:Casp8ap2	UTSW	4	32640790	missense	probably benign	0.28
R1165:Casp8ap2	UTSW	4	32640563	missense	probably benign	0.01
R1243:Casp8ap2	UTSW	4	32645687	missense	probably benign	0.03
R1311:Casp8ap2	UTSW	4	32648111	missense	probably damaging	0.98
R1337:Casp8ap2	UTSW	4	32645721	missense	possibly damaging	0.64
R1471:Casp8ap2	UTSW	4	32639386	nonsense	probably null
R1497:Casp8ap2	UTSW	4	32639938	missense	probably benign	0.00
R1521:Casp8ap2	UTSW	4	32631867	missense	probably damaging	1.00
R1588:Casp8ap2	UTSW	4	32640541	missense	probably benign	0.00
R1625:Casp8ap2	UTSW	4	32648068	missense	probably benign	0.04
R1731:Casp8ap2	UTSW	4	32641442	missense	possibly damaging	0.94
R1899:Casp8ap2	UTSW	4	32643647	missense	probably damaging	0.98
R2000:Casp8ap2	UTSW	4	32634874	missense	probably damaging	1.00
R2021:Casp8ap2	UTSW	4	32644560	missense	probably benign	0.05
R2022:Casp8ap2	UTSW	4	32644560	missense	probably benign	0.05
R2023:Casp8ap2	UTSW	4	32644560	missense	probably benign	0.05
R2088:Casp8ap2	UTSW	4	32631126	missense	probably damaging	1.00
R2104:Casp8ap2	UTSW	4	32644727	missense	probably benign	0.00
R2129:Casp8ap2	UTSW	4	32640142	missense	probably benign	0.06
R2305:Casp8ap2	UTSW	4	32646411	missense	probably damaging	1.00
R2316:Casp8ap2	UTSW	4	32643781	missense	probably benign	0.31
R2919:Casp8ap2	UTSW	4	32645343	missense	probably damaging	1.00
R4091:Casp8ap2	UTSW	4	32643611	missense	probably damaging	1.00
R4357:Casp8ap2	UTSW	4	32646150	missense	probably benign	0.00
R4807:Casp8ap2	UTSW	4	32644505	missense	possibly damaging	0.89
R4828:Casp8ap2	UTSW	4	32639807	missense	probably benign
R4908:Casp8ap2	UTSW	4	32639905	missense	possibly damaging	0.90
R4945:Casp8ap2	UTSW	4	32631163	missense	possibly damaging	0.57
R4962:Casp8ap2	UTSW	4	32640554	missense	probably damaging	0.99
R6014:Casp8ap2	UTSW	4	32641400	missense	probably damaging	0.97
R6092:Casp8ap2	UTSW	4	32639380	missense	probably damaging	1.00
R6257:Casp8ap2	UTSW	4	32641364	missense	possibly damaging	0.94
R6289:Casp8ap2	UTSW	4	32639590	missense	probably damaging	1.00
R6482:Casp8ap2	UTSW	4	32634813	missense	probably damaging	1.00
R6496:Casp8ap2	UTSW	4	32641553	missense	probably benign	0.05
R6515:Casp8ap2	UTSW	4	32646423	missense	possibly damaging	0.64
R7015:Casp8ap2	UTSW	4	32644278	missense	probably damaging	1.00
R7033:Casp8ap2	UTSW	4	32639392	missense	probably damaging	1.00
R7072:Casp8ap2	UTSW	4	32644766	missense	probably damaging	1.00
R7448:Casp8ap2	UTSW	4	32643974	missense	possibly damaging	0.84
R7944:Casp8ap2	UTSW	4	32645909	missense	probably benign	0.12
R7945:Casp8ap2	UTSW	4	32645909	missense	probably benign	0.12
R8170:Casp8ap2	UTSW	4	32615490	splice site	probably benign
R8179:Casp8ap2	UTSW	4	32643939	nonsense	probably null
R8207:Casp8ap2	UTSW	4	32646446	missense	possibly damaging	0.63
R8263:Casp8ap2	UTSW	4	32644072	missense	probably damaging	1.00
R8298:Casp8ap2	UTSW	4	32640429	missense	probably benign	0.30
V7580:Casp8ap2	UTSW	4	32639944	missense	probably benign	0.00
X0018:Casp8ap2	UTSW	4	32643738	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- GAGACTTCCAGAGAAAGGCCAC -3'
(R):5'- AGGAGTATTTTCCCACTGGTG -3'

Sequencing Primer
(F):5'- TCGAGTGGAATCTCAACATGAC -3'
(R):5'- GTGTGCAACACTAACTTCCTTGGAG -3'

Posted On

2014-09-17