Incidental Mutation 'R2128:Uso1'
ID227715
Institutional Source Beutler Lab
Gene Symbol Uso1
Ensembl Gene ENSMUSG00000029407
Gene NameUSO1 vesicle docking factor
SynonymsVdp, TAP, transcytosis associated protein p115
MMRRC Submission 040131-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2128 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location92137938-92202798 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 92195370 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 771 (M771K)
Ref Sequence ENSEMBL: ENSMUSP00000031355 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031355] [ENSMUST00000201642] [ENSMUST00000202155]
Predicted Effect probably benign
Transcript: ENSMUST00000031355
AA Change: M771K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000031355
Gene: ENSMUSG00000029407
AA Change: M771K

DomainStartEndE-ValueType
Blast:ARM 47 91 1e-18 BLAST
low complexity region 94 100 N/A INTRINSIC
Blast:ARM 155 195 2e-15 BLAST
Blast:ARM 300 342 3e-19 BLAST
Pfam:Uso1_p115_head 344 628 6.5e-72 PFAM
low complexity region 630 643 N/A INTRINSIC
low complexity region 661 672 N/A INTRINSIC
low complexity region 730 744 N/A INTRINSIC
Pfam:Uso1_p115_C 782 954 1.6e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122796
Predicted Effect probably benign
Transcript: ENSMUST00000201642
SMART Domains Protein: ENSMUSP00000144165
Gene: ENSMUSG00000029407

DomainStartEndE-ValueType
PDB:3GRL|A 1 52 5e-24 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000202155
SMART Domains Protein: ENSMUSP00000144592
Gene: ENSMUSG00000029407

DomainStartEndE-ValueType
Blast:ARM 47 91 1e-18 BLAST
low complexity region 94 100 N/A INTRINSIC
Blast:ARM 155 195 2e-15 BLAST
Blast:ARM 300 342 3e-19 BLAST
Pfam:Uso1_p115_head 344 628 5.7e-72 PFAM
low complexity region 630 643 N/A INTRINSIC
low complexity region 661 672 N/A INTRINSIC
Pfam:Uso1_p115_C 730 892 2.1e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202362
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202399
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a peripheral membrane protein which recycles between the cytosol and the Golgi apparatus during interphase. It is regulated by phosphorylation: dephosphorylated protein associates with the Golgi membrane and dissociates from the membrane upon phosphorylation. Ras-associated protein 1 recruits this protein to coat protein complex II (COPII) vesicles during budding from the endoplasmic reticulum, where it interacts with a set of COPII vesicle-associated SNAREs to form a cis-SNARE complex that promotes targeting to the Golgi apparatus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit embryonic lethality between E3.5 and E8.5 with disruption of Golgi apparatus in blastocyst cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik A G 10: 87,230,204 E249G possibly damaging Het
2610028H24Rik A G 10: 76,457,515 M136V possibly damaging Het
4930523C07Rik A T 1: 160,075,375 K72* probably null Het
Abca6 A G 11: 110,219,649 I558T probably benign Het
Acot10 T C 15: 20,666,626 T10A probably benign Het
Adgrl4 T A 3: 151,500,201 D233E probably benign Het
Adgrv1 A T 13: 81,557,080 F1537Y probably damaging Het
Akap2 A G 4: 57,854,890 Y134C probably benign Het
Aqp3 T A 4: 41,098,061 I17F probably benign Het
Arap1 T A 7: 101,409,320 L1375H probably damaging Het
Aspm T C 1: 139,457,635 V339A probably benign Het
Atp13a3 G A 16: 30,354,276 A261V probably damaging Het
Casp8ap2 T C 4: 32,640,142 Y399H probably benign Het
Cept1 A G 3: 106,512,879 V213A probably damaging Het
Cit A G 5: 115,985,507 D1469G possibly damaging Het
Cnga2 A G X: 72,007,788 Y182C possibly damaging Het
Cox20 A G 1: 178,321,947 I54V probably benign Het
Dhx8 C A 11: 101,738,409 D261E probably benign Het
Dnah2 A T 11: 69,458,185 I2486N probably benign Het
Dnah5 A G 15: 28,408,321 Q3484R probably benign Het
Drd1 T C 13: 54,053,553 Y207C probably damaging Het
Dtl C T 1: 191,558,110 V222I probably damaging Het
Dync1h1 T C 12: 110,640,882 Y2636H probably damaging Het
Endog C A 2: 30,172,036 D154E probably benign Het
Epc1 A T 18: 6,462,954 V14E probably damaging Het
Ercc4 C A 16: 13,147,934 T810K probably damaging Het
Fam43b T A 4: 138,395,988 N7I possibly damaging Het
Fgd1 T C X: 151,086,217 probably null Het
Filip1 G T 9: 79,819,330 T669N probably damaging Het
Fndc1 A G 17: 7,778,665 probably benign Het
Foxk1 C A 5: 142,435,188 S189* probably null Het
Gatm T C 2: 122,600,536 N274S probably damaging Het
Gdf9 A G 11: 53,437,507 Y430C probably damaging Het
Gga1 C T 15: 78,888,448 P260S probably damaging Het
Gm11595 A T 11: 99,772,501 C118S unknown Het
Gm382 G T X: 127,062,651 V820L possibly damaging Het
Gzmk T A 13: 113,172,014 I179F probably damaging Het
Hsp90b1 T C 10: 86,695,706 D421G probably damaging Het
Hus1 A G 11: 9,006,011 M174T probably damaging Het
Ifngr2 T A 16: 91,562,873 Y289* probably null Het
Il6st T A 13: 112,504,175 H828Q probably benign Het
Impg2 T A 16: 56,218,379 Y127N probably damaging Het
Irf3 T A 7: 45,001,744 W345R probably damaging Het
Kif1b G A 4: 149,187,640 S1568L possibly damaging Het
Klhl42 A G 6: 147,101,753 T342A probably benign Het
Kndc1 G T 7: 139,930,112 R1289L probably damaging Het
Knl1 A T 2: 119,071,819 T1334S possibly damaging Het
L3mbtl3 G T 10: 26,313,868 D499E unknown Het
Ldhd T A 8: 111,627,048 M478L probably benign Het
Loxl4 C G 19: 42,603,963 E385D probably damaging Het
Lrriq1 G A 10: 103,214,857 T678I probably benign Het
Macf1 T A 4: 123,492,774 I1017F probably benign Het
Madcam1 A G 10: 79,665,572 E157G possibly damaging Het
Mamdc4 T C 2: 25,569,258 D195G probably damaging Het
Mctp1 A G 13: 76,824,822 D648G probably damaging Het
Mycbp2 T C 14: 103,201,230 M2072V probably benign Het
Nck1 A G 9: 100,497,547 probably null Het
Ndufaf4 G T 4: 24,898,608 D55Y probably damaging Het
Nek11 A T 9: 105,300,361 D230E probably benign Het
Nit2 T C 16: 57,161,196 K67E possibly damaging Het
Olfr2 T C 7: 107,001,248 D204G probably damaging Het
Olfr290 T C 7: 84,916,493 F238S probably damaging Het
Olfr527 C T 7: 140,336,429 T189M probably damaging Het
Olfr802 A T 10: 129,682,532 V69E possibly damaging Het
Pccb G C 9: 100,985,831 D347E probably damaging Het
Plcl1 T A 1: 55,697,838 F779L probably damaging Het
Prune2 C A 19: 17,122,422 D1763E probably benign Het
Pwwp2a A G 11: 43,705,318 S437G probably benign Het
Rabgap1l A T 1: 160,738,957 D90E probably benign Het
Rapgef4 T A 2: 72,226,553 I552N possibly damaging Het
Scn7a A T 2: 66,697,986 I720K probably damaging Het
Scn9a T A 2: 66,526,654 N1101I probably damaging Het
Siglec1 A T 2: 131,080,497 Y553N probably damaging Het
Slc22a23 A G 13: 34,203,970 L381P possibly damaging Het
Slc7a11 T A 3: 50,384,109 T284S probably damaging Het
Slc8a2 T A 7: 16,140,492 probably null Het
Snx29 T A 16: 11,400,971 S224T probably damaging Het
Stox1 T C 10: 62,664,535 T749A probably benign Het
Tg A G 15: 66,694,894 I1264V probably benign Het
Tmem110 T C 14: 30,866,624 Y103H probably damaging Het
Top2a A C 11: 99,009,807 V609G probably damaging Het
Trmt44 G A 5: 35,574,832 P72S probably benign Het
Ttll3 G C 6: 113,412,934 S760T probably benign Het
Ttn T C 2: 76,748,678 D23957G probably damaging Het
Ttn G A 2: 76,833,897 probably benign Het
Ubxn1 T G 19: 8,872,070 V59G probably benign Het
Ubxn4 T C 1: 128,244,510 S14P probably benign Het
Utp20 A G 10: 88,814,055 F431S probably damaging Het
Vmn1r206 T C 13: 22,620,612 S142G probably benign Het
Vmn2r19 A G 6: 123,308,330 probably null Het
Vps36 G T 8: 22,218,289 probably null Het
Wnt3 A G 11: 103,812,648 H319R possibly damaging Het
Zbtb26 G T 2: 37,436,551 Q158K probably benign Het
Zfp648 T C 1: 154,204,607 S171P probably benign Het
Other mutations in Uso1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01522:Uso1 APN 5 92181419 missense probably damaging 0.96
IGL01753:Uso1 APN 5 92152918 critical splice donor site probably null
IGL02311:Uso1 APN 5 92187776 missense probably benign
IGL02539:Uso1 APN 5 92187773 missense probably damaging 1.00
IGL02716:Uso1 APN 5 92173935 missense probably damaging 0.99
IGL03154:Uso1 APN 5 92180618 nonsense probably null
R0558:Uso1 UTSW 5 92174019 missense probably benign 0.03
R0570:Uso1 UTSW 5 92199823 missense probably benign 0.19
R1195:Uso1 UTSW 5 92170747 missense probably damaging 1.00
R1195:Uso1 UTSW 5 92170747 missense probably damaging 1.00
R1195:Uso1 UTSW 5 92170747 missense probably damaging 1.00
R1398:Uso1 UTSW 5 92181468 missense probably benign 0.16
R1485:Uso1 UTSW 5 92180563 missense possibly damaging 0.76
R1813:Uso1 UTSW 5 92201133 critical splice acceptor site probably null
R1873:Uso1 UTSW 5 92192859 splice site probably benign
R1896:Uso1 UTSW 5 92201133 critical splice acceptor site probably null
R1899:Uso1 UTSW 5 92201192 missense probably benign 0.27
R2049:Uso1 UTSW 5 92181936 missense probably damaging 1.00
R2411:Uso1 UTSW 5 92158399 splice site probably benign
R2903:Uso1 UTSW 5 92195435 critical splice donor site probably null
R5055:Uso1 UTSW 5 92192735 missense probably benign 0.31
R5155:Uso1 UTSW 5 92167335 critical splice donor site probably null
R5590:Uso1 UTSW 5 92180608 missense probably benign 0.05
R5665:Uso1 UTSW 5 92198337 missense possibly damaging 0.95
R5677:Uso1 UTSW 5 92201299 missense probably damaging 1.00
R5996:Uso1 UTSW 5 92192730 missense probably benign 0.00
R6165:Uso1 UTSW 5 92187267 missense probably damaging 1.00
R6340:Uso1 UTSW 5 92199852 missense probably benign 0.01
R6701:Uso1 UTSW 5 92166585 missense probably damaging 1.00
R6860:Uso1 UTSW 5 92195348 missense probably benign 0.11
R7062:Uso1 UTSW 5 92192740 missense possibly damaging 0.62
R7133:Uso1 UTSW 5 92158465 missense probably benign 0.12
R7317:Uso1 UTSW 5 92173992 missense possibly damaging 0.70
R7527:Uso1 UTSW 5 92199875 missense possibly damaging 0.58
R7648:Uso1 UTSW 5 92194002 splice site probably null
R7707:Uso1 UTSW 5 92201936 makesense probably null
R8009:Uso1 UTSW 5 92166580 missense probably benign 0.03
R8104:Uso1 UTSW 5 92158421 missense probably damaging 0.99
R8361:Uso1 UTSW 5 92189262 missense probably null 0.00
Z1177:Uso1 UTSW 5 92138130 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CTGAGTGTAACTTCTGAGGCTG -3'
(R):5'- GTCAAGTAAACACAGCTTCTAGG -3'

Sequencing Primer
(F):5'- CTGTAGACAGCGCTCTATTGAAATAG -3'
(R):5'- CACAGCTTCTAGGTTTTTCAAAGC -3'
Posted On2014-09-17