Mutagenetix > Incidental Mutations

Incidental Mutation 'R2128:Cit'

227716

Institutional Source

Beutler Lab

Gene Symbol

Cit

Ensembl Gene

ENSMUSG00000029516

Gene Name

citron

Synonyms

CRIK-SK, C030025P15Rik, Cit-k, citron-N, citron kinase

MMRRC Submission

040131-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.931) question?

Stock #

R2128 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

115845278-116008947 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 115985507 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 1469 (D1469G)

Ref Sequence

ENSEMBL: ENSMUSP00000099620 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000051704] [ENSMUST00000102560] [ENSMUST00000112008] [ENSMUST00000141101]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000051704
AA Change: D1454G

PolyPhen 2 Score 0.629 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000062049
Gene: ENSMUSG00000029516
AA Change: D1454G

Domain	Start	End	E-Value	Type
S_TKc	97	359	2.92e-89	SMART
S_TK_X	360	422	6.32e-16	SMART
low complexity region	632	646	N/A	INTRINSIC
low complexity region	891	905	N/A	INTRINSIC
low complexity region	915	948	N/A	INTRINSIC
low complexity region	950	968	N/A	INTRINSIC
low complexity region	1068	1081	N/A	INTRINSIC
low complexity region	1138	1156	N/A	INTRINSIC
low complexity region	1182	1203	N/A	INTRINSIC
internal_repeat_1	1243	1282	1.05e-5	PROSPERO
low complexity region	1353	1364	N/A	INTRINSIC
C1	1389	1437	1.97e-9	SMART
PH	1470	1591	1.31e-8	SMART
CNH	1618	1915	1.78e-112	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102560
AA Change: D1469G

PolyPhen 2 Score 0.629 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000099620
Gene: ENSMUSG00000029516
AA Change: D1469G

Domain	Start	End	E-Value	Type
S_TKc	97	359	2.92e-89	SMART
S_TK_X	360	422	6.32e-16	SMART
coiled coil region	452	1244	N/A	INTRINSIC
coiled coil region	1297	1338	N/A	INTRINSIC
low complexity region	1368	1379	N/A	INTRINSIC
C1	1404	1452	1.97e-9	SMART
PH	1485	1606	1.31e-8	SMART
CNH	1633	1930	1.78e-112	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000112008
AA Change: D1427G

PolyPhen 2 Score 0.571 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000107639
Gene: ENSMUSG00000029516
AA Change: D1427G

Domain	Start	End	E-Value	Type
S_TKc	97	359	2.92e-89	SMART
S_TK_X	360	422	6.32e-16	SMART
coiled coil region	452	1202	N/A	INTRINSIC
coiled coil region	1255	1296	N/A	INTRINSIC
low complexity region	1326	1337	N/A	INTRINSIC
C1	1362	1410	1.97e-9	SMART
PH	1443	1564	1.31e-8	SMART
CNH	1591	1888	1.78e-112	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122877

Predicted Effect

probably benign
Transcript: ENSMUST00000123736

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134609

Predicted Effect

possibly damaging
Transcript: ENSMUST00000141101
AA Change: D1412G

PolyPhen 2 Score 0.571 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000115802
Gene: ENSMUSG00000029516
AA Change: D1412G

Domain	Start	End	E-Value	Type
S_TKc	97	359	1.4e-91	SMART
S_TK_X	360	422	3e-18	SMART
low complexity region	632	646	N/A	INTRINSIC
low complexity region	686	698	N/A	INTRINSIC
low complexity region	849	863	N/A	INTRINSIC
low complexity region	873	906	N/A	INTRINSIC
low complexity region	908	926	N/A	INTRINSIC
low complexity region	1026	1039	N/A	INTRINSIC
low complexity region	1096	1114	N/A	INTRINSIC
low complexity region	1140	1161	N/A	INTRINSIC
internal_repeat_1	1201	1240	1.73e-5	PROSPERO
low complexity region	1311	1322	N/A	INTRINSIC
C1	1347	1395	9.7e-12	SMART
PH	1428	1549	6e-11	SMART
CNH	1576	1873	8.6e-115	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145363

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147479

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine-protein kinase that functions in cell division. Together with the kinesin KIF14, this protein localizes to the central spindle and midbody, and functions to promote efficient cytokinesis. This protein is involved in central nervous system development. Polymorphisms in this gene are associated with bipolar disorder and risk for schizophrenia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygotes for a null mutation are 20% smaller than wild-type and exhibit tremors, ataxia, and fatal seizures. Brains of mutant mice show a 50% size reduction with abnormalities in the hippocampus, cerebellum, and olfactory lobes. Mutant males show aberrant cytokinesis of spermatogenic precursors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 94 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700113H08Rik	A	G	10: 87,230,204	E249G	possibly damaging	Het
2610028H24Rik	A	G	10: 76,457,515	M136V	possibly damaging	Het
4930523C07Rik	A	T	1: 160,075,375	K72*	probably null	Het
Abca6	A	G	11: 110,219,649	I558T	probably benign	Het
Acot10	T	C	15: 20,666,626	T10A	probably benign	Het
Adgrl4	T	A	3: 151,500,201	D233E	probably benign	Het
Adgrv1	A	T	13: 81,557,080	F1537Y	probably damaging	Het
Akap2	A	G	4: 57,854,890	Y134C	probably benign	Het
Aqp3	T	A	4: 41,098,061	I17F	probably benign	Het
Arap1	T	A	7: 101,409,320	L1375H	probably damaging	Het
Aspm	T	C	1: 139,457,635	V339A	probably benign	Het
Atp13a3	G	A	16: 30,354,276	A261V	probably damaging	Het
Casp8ap2	T	C	4: 32,640,142	Y399H	probably benign	Het
Cept1	A	G	3: 106,512,879	V213A	probably damaging	Het
Cnga2	A	G	X: 72,007,788	Y182C	possibly damaging	Het
Cox20	A	G	1: 178,321,947	I54V	probably benign	Het
Dhx8	C	A	11: 101,738,409	D261E	probably benign	Het
Dnah2	A	T	11: 69,458,185	I2486N	probably benign	Het
Dnah5	A	G	15: 28,408,321	Q3484R	probably benign	Het
Drd1	T	C	13: 54,053,553	Y207C	probably damaging	Het
Dtl	C	T	1: 191,558,110	V222I	probably damaging	Het
Dync1h1	T	C	12: 110,640,882	Y2636H	probably damaging	Het
Endog	C	A	2: 30,172,036	D154E	probably benign	Het
Epc1	A	T	18: 6,462,954	V14E	probably damaging	Het
Ercc4	C	A	16: 13,147,934	T810K	probably damaging	Het
Fam43b	T	A	4: 138,395,988	N7I	possibly damaging	Het
Fgd1	T	C	X: 151,086,217		probably null	Het
Filip1	G	T	9: 79,819,330	T669N	probably damaging	Het
Fndc1	A	G	17: 7,778,665		probably benign	Het
Foxk1	C	A	5: 142,435,188	S189*	probably null	Het
Gatm	T	C	2: 122,600,536	N274S	probably damaging	Het
Gdf9	A	G	11: 53,437,507	Y430C	probably damaging	Het
Gga1	C	T	15: 78,888,448	P260S	probably damaging	Het
Gm11595	A	T	11: 99,772,501	C118S	unknown	Het
Gm382	G	T	X: 127,062,651	V820L	possibly damaging	Het
Gzmk	T	A	13: 113,172,014	I179F	probably damaging	Het
Hsp90b1	T	C	10: 86,695,706	D421G	probably damaging	Het
Hus1	A	G	11: 9,006,011	M174T	probably damaging	Het
Ifngr2	T	A	16: 91,562,873	Y289*	probably null	Het
Il6st	T	A	13: 112,504,175	H828Q	probably benign	Het
Impg2	T	A	16: 56,218,379	Y127N	probably damaging	Het
Irf3	T	A	7: 45,001,744	W345R	probably damaging	Het
Kif1b	G	A	4: 149,187,640	S1568L	possibly damaging	Het
Klhl42	A	G	6: 147,101,753	T342A	probably benign	Het
Kndc1	G	T	7: 139,930,112	R1289L	probably damaging	Het
Knl1	A	T	2: 119,071,819	T1334S	possibly damaging	Het
L3mbtl3	G	T	10: 26,313,868	D499E	unknown	Het
Ldhd	T	A	8: 111,627,048	M478L	probably benign	Het
Loxl4	C	G	19: 42,603,963	E385D	probably damaging	Het
Lrriq1	G	A	10: 103,214,857	T678I	probably benign	Het
Macf1	T	A	4: 123,492,774	I1017F	probably benign	Het
Madcam1	A	G	10: 79,665,572	E157G	possibly damaging	Het
Mamdc4	T	C	2: 25,569,258	D195G	probably damaging	Het
Mctp1	A	G	13: 76,824,822	D648G	probably damaging	Het
Mycbp2	T	C	14: 103,201,230	M2072V	probably benign	Het
Nck1	A	G	9: 100,497,547		probably null	Het
Ndufaf4	G	T	4: 24,898,608	D55Y	probably damaging	Het
Nek11	A	T	9: 105,300,361	D230E	probably benign	Het
Nit2	T	C	16: 57,161,196	K67E	possibly damaging	Het
Olfr2	T	C	7: 107,001,248	D204G	probably damaging	Het
Olfr290	T	C	7: 84,916,493	F238S	probably damaging	Het
Olfr527	C	T	7: 140,336,429	T189M	probably damaging	Het
Olfr802	A	T	10: 129,682,532	V69E	possibly damaging	Het
Pccb	G	C	9: 100,985,831	D347E	probably damaging	Het
Plcl1	T	A	1: 55,697,838	F779L	probably damaging	Het
Prune2	C	A	19: 17,122,422	D1763E	probably benign	Het
Pwwp2a	A	G	11: 43,705,318	S437G	probably benign	Het
Rabgap1l	A	T	1: 160,738,957	D90E	probably benign	Het
Rapgef4	T	A	2: 72,226,553	I552N	possibly damaging	Het
Scn7a	A	T	2: 66,697,986	I720K	probably damaging	Het
Scn9a	T	A	2: 66,526,654	N1101I	probably damaging	Het
Siglec1	A	T	2: 131,080,497	Y553N	probably damaging	Het
Slc22a23	A	G	13: 34,203,970	L381P	possibly damaging	Het
Slc7a11	T	A	3: 50,384,109	T284S	probably damaging	Het
Slc8a2	T	A	7: 16,140,492		probably null	Het
Snx29	T	A	16: 11,400,971	S224T	probably damaging	Het
Stox1	T	C	10: 62,664,535	T749A	probably benign	Het
Tg	A	G	15: 66,694,894	I1264V	probably benign	Het
Tmem110	T	C	14: 30,866,624	Y103H	probably damaging	Het
Top2a	A	C	11: 99,009,807	V609G	probably damaging	Het
Trmt44	G	A	5: 35,574,832	P72S	probably benign	Het
Ttll3	G	C	6: 113,412,934	S760T	probably benign	Het
Ttn	T	C	2: 76,748,678	D23957G	probably damaging	Het
Ttn	G	A	2: 76,833,897		probably benign	Het
Ubxn1	T	G	19: 8,872,070	V59G	probably benign	Het
Ubxn4	T	C	1: 128,244,510	S14P	probably benign	Het
Uso1	T	A	5: 92,195,370	M771K	probably benign	Het
Utp20	A	G	10: 88,814,055	F431S	probably damaging	Het
Vmn1r206	T	C	13: 22,620,612	S142G	probably benign	Het
Vmn2r19	A	G	6: 123,308,330		probably null	Het
Vps36	G	T	8: 22,218,289		probably null	Het
Wnt3	A	G	11: 103,812,648	H319R	possibly damaging	Het
Zbtb26	G	T	2: 37,436,551	Q158K	probably benign	Het
Zfp648	T	C	1: 154,204,607	S171P	probably benign	Het

Other mutations in Cit

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00321:Cit	APN	5	115846465	missense	probably damaging	0.99
IGL00482:Cit	APN	5	115938755	missense	probably damaging	0.97
IGL01317:Cit	APN	5	115908716	missense	probably benign	0.03
IGL01335:Cit	APN	5	115908830	splice site	probably benign
IGL01415:Cit	APN	5	115941903	missense	possibly damaging	0.78
IGL01447:Cit	APN	5	115873843	splice site	probably benign
IGL01537:Cit	APN	5	115933854	missense	probably benign	0.00
IGL01621:Cit	APN	5	115992603	splice site	probably benign
IGL02010:Cit	APN	5	115875947	missense	probably damaging	1.00
IGL02538:Cit	APN	5	115986989	nonsense	probably null
IGL02607:Cit	APN	5	115859209	missense	probably benign
IGL02720:Cit	APN	5	115995452	missense	probably benign	0.26
IGL02725:Cit	APN	5	115985473	missense	probably benign	0.02
IGL02967:Cit	APN	5	115945837	missense	probably benign	0.11
IGL02973:Cit	APN	5	116005999	missense	possibly damaging	0.73
IGL03383:Cit	APN	5	115873845	splice site	probably benign
PIT4514001:Cit	UTSW	5	115997854	critical splice donor site	probably null
R0206:Cit	UTSW	5	115994030	missense	possibly damaging	0.72
R0206:Cit	UTSW	5	115994030	missense	possibly damaging	0.72
R0226:Cit	UTSW	5	115984840	missense	probably damaging	0.99
R0320:Cit	UTSW	5	115979445	missense	possibly damaging	0.87
R0401:Cit	UTSW	5	115985479	missense	probably benign	0.06
R0480:Cit	UTSW	5	115933393	splice site	probably benign
R0609:Cit	UTSW	5	115873943	missense	probably damaging	0.98
R0737:Cit	UTSW	5	115946919	missense	probably damaging	1.00
R1238:Cit	UTSW	5	115851221	missense	probably benign	0.30
R1503:Cit	UTSW	5	115873900	missense	possibly damaging	0.94
R1551:Cit	UTSW	5	115945842	missense	probably benign	0.00
R1602:Cit	UTSW	5	115997730	missense	probably damaging	1.00
R1720:Cit	UTSW	5	115967897	missense	probably damaging	0.98
R1854:Cit	UTSW	5	115873901	missense	probably damaging	1.00
R1886:Cit	UTSW	5	115933486	missense	probably damaging	1.00
R2024:Cit	UTSW	5	115947924	missense	probably damaging	0.97
R2024:Cit	UTSW	5	116005840	missense	probably damaging	0.97
R2048:Cit	UTSW	5	115886813	splice site	probably null
R2192:Cit	UTSW	5	115968009	missense	probably benign	0.00
R2244:Cit	UTSW	5	115926505	missense	probably damaging	1.00
R2518:Cit	UTSW	5	115987046	missense	probably damaging	0.99
R2679:Cit	UTSW	5	115969115	missense	probably benign	0.00
R2898:Cit	UTSW	5	115873978	splice site	probably null
R2908:Cit	UTSW	5	115981676	missense	probably benign	0.00
R3079:Cit	UTSW	5	115925486	missense	probably damaging	0.97
R3779:Cit	UTSW	5	115859341	missense	probably benign	0.01
R4081:Cit	UTSW	5	115948050	missense	probably damaging	1.00
R4494:Cit	UTSW	5	115873984	missense	probably damaging	1.00
R4610:Cit	UTSW	5	115994087	missense	probably benign	0.01
R4757:Cit	UTSW	5	115997549	missense	probably damaging	1.00
R4788:Cit	UTSW	5	115933506	missense	probably damaging	1.00
R4816:Cit	UTSW	5	115908691	missense	probably damaging	1.00
R4890:Cit	UTSW	5	115988123	intron	probably benign
R4899:Cit	UTSW	5	115863028	missense	possibly damaging	0.60
R4928:Cit	UTSW	5	115985797	missense	probably benign	0.00
R5073:Cit	UTSW	5	115946843	missense	probably benign	0.24
R5151:Cit	UTSW	5	115979835	missense	probably damaging	1.00
R5154:Cit	UTSW	5	115988405	missense	probably damaging	1.00
R5222:Cit	UTSW	5	115952543	missense	probably benign	0.03
R5814:Cit	UTSW	5	115979419	missense	probably damaging	1.00
R5935:Cit	UTSW	5	115925539	intron	probably benign
R5946:Cit	UTSW	5	115997534	missense	probably damaging	1.00
R6051:Cit	UTSW	5	115846405	missense	probably benign
R6289:Cit	UTSW	5	116006326	makesense	probably null
R6298:Cit	UTSW	5	115948065	missense	probably damaging	1.00
R6362:Cit	UTSW	5	115886676	missense	probably benign	0.01
R6545:Cit	UTSW	5	115846434	missense	probably null	0.00
R6761:Cit	UTSW	5	115908675	missense	probably damaging	1.00
R6798:Cit	UTSW	5	115926526	missense	possibly damaging	0.56
R6814:Cit	UTSW	5	115884963	missense	probably damaging	1.00
R6825:Cit	UTSW	5	115981774	missense	probably damaging	0.99
R6845:Cit	UTSW	5	115984888	missense	probably damaging	1.00
R6983:Cit	UTSW	5	115994091	missense	probably damaging	1.00
R7164:Cit	UTSW	5	115985787	missense	possibly damaging	0.94
R7359:Cit	UTSW	5	115926574	missense	probably damaging	1.00
R7597:Cit	UTSW	5	115886681	nonsense	probably null
R7729:Cit	UTSW	5	115984822	missense	possibly damaging	0.87
R7763:Cit	UTSW	5	115987001	missense	probably benign	0.01
R7786:Cit	UTSW	5	115863018	missense	probably benign	0.00
R7799:Cit	UTSW	5	115862968	missense	probably benign	0.00
R8060:Cit	UTSW	5	115908727	missense	probably benign	0.00
R8068:Cit	UTSW	5	115952466	missense	probably damaging	1.00
R8068:Cit	UTSW	5	115982235	missense	probably benign	0.03
R8122:Cit	UTSW	5	115969010	missense	probably damaging	1.00
R8177:Cit	UTSW	5	115988159	missense	probably benign	0.18
R8178:Cit	UTSW	5	115969072	missense	probably damaging	1.00
R8265:Cit	UTSW	5	115988177	missense	probably damaging	1.00
R8359:Cit	UTSW	5	115984544	splice site	probably null
R8397:Cit	UTSW	5	115886797	missense	probably benign
R8489:Cit	UTSW	5	115945903	critical splice donor site	probably null
R8784:Cit	UTSW	5	115846383	nonsense	probably null
R8798:Cit	UTSW	5	115969043	missense	not run
Z1088:Cit	UTSW	5	115985533	missense	possibly damaging	0.62
Z1176:Cit	UTSW	5	115986603	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTGGCACCTGGGGAAGTATC -3'
(R):5'- AACAATGTACTTCCTGTCCCAGC -3'

Sequencing Primer
(F):5'- CTGGGGAAGTATCAGGATGGCC -3'
(R):5'- TGTCTCAGAATGGAGAAGCAAGC -3'

Posted On

2014-09-17