Incidental Mutation 'R2128:Ttll3'
ID227720
Institutional Source Beutler Lab
Gene Symbol Ttll3
Ensembl Gene ENSMUSG00000030276
Gene Nametubulin tyrosine ligase-like family, member 3
Synonyms
MMRRC Submission 040131-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2128 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location113389260-113414587 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 113412934 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 760 (S760T)
Ref Sequence ENSEMBL: ENSMUSP00000032414 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032414] [ENSMUST00000038889] [ENSMUST00000060634] [ENSMUST00000113092] [ENSMUST00000129047] [ENSMUST00000129560] [ENSMUST00000205017]
Predicted Effect probably benign
Transcript: ENSMUST00000032414
AA Change: S760T

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000032414
Gene: ENSMUSG00000030276
AA Change: S760T

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
low complexity region 214 231 N/A INTRINSIC
low complexity region 234 248 N/A INTRINSIC
Pfam:TTL 404 698 7.7e-84 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000038889
AA Change: S761T

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000037870
Gene: ENSMUSG00000030276
AA Change: S761T

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
low complexity region 214 231 N/A INTRINSIC
low complexity region 234 248 N/A INTRINSIC
Pfam:TTL 404 699 9e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000060634
SMART Domains Protein: ENSMUSP00000059057
Gene: ENSMUSG00000051169

DomainStartEndE-ValueType
Pfam:PseudoU_synth_2 82 236 1.8e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113092
SMART Domains Protein: ENSMUSP00000108715
Gene: ENSMUSG00000051169

DomainStartEndE-ValueType
Pfam:PseudoU_synth_2 82 246 7.4e-20 PFAM
low complexity region 303 312 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124078
Predicted Effect probably benign
Transcript: ENSMUST00000129047
SMART Domains Protein: ENSMUSP00000120380
Gene: ENSMUSG00000051169

DomainStartEndE-ValueType
Pfam:PseudoU_synth_2 82 246 5.9e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129560
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134853
Predicted Effect probably benign
Transcript: ENSMUST00000147726
SMART Domains Protein: ENSMUSP00000120250
Gene: ENSMUSG00000051169

DomainStartEndE-ValueType
Pfam:PseudoU_synth_2 71 235 2.8e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151618
SMART Domains Protein: ENSMUSP00000115950
Gene: ENSMUSG00000051169

DomainStartEndE-ValueType
Pfam:PseudoU_synth_2 72 179 5.2e-9 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000203524
AA Change: S607T
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203758
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203880
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204255
Predicted Effect probably benign
Transcript: ENSMUST00000205017
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203925
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204498
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit a reduced number of primary cilia in colon epithelia accompanied by an increased rate of cell division which is compensated by faster tissue turnover in the colon. Mice exhibit increased incidence of colon tumors by chemical induction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik A G 10: 87,230,204 E249G possibly damaging Het
2610028H24Rik A G 10: 76,457,515 M136V possibly damaging Het
4930523C07Rik A T 1: 160,075,375 K72* probably null Het
Abca6 A G 11: 110,219,649 I558T probably benign Het
Acot10 T C 15: 20,666,626 T10A probably benign Het
Adgrl4 T A 3: 151,500,201 D233E probably benign Het
Adgrv1 A T 13: 81,557,080 F1537Y probably damaging Het
Akap2 A G 4: 57,854,890 Y134C probably benign Het
Aqp3 T A 4: 41,098,061 I17F probably benign Het
Arap1 T A 7: 101,409,320 L1375H probably damaging Het
Aspm T C 1: 139,457,635 V339A probably benign Het
Atp13a3 G A 16: 30,354,276 A261V probably damaging Het
Casp8ap2 T C 4: 32,640,142 Y399H probably benign Het
Cept1 A G 3: 106,512,879 V213A probably damaging Het
Cit A G 5: 115,985,507 D1469G possibly damaging Het
Cnga2 A G X: 72,007,788 Y182C possibly damaging Het
Cox20 A G 1: 178,321,947 I54V probably benign Het
Dhx8 C A 11: 101,738,409 D261E probably benign Het
Dnah2 A T 11: 69,458,185 I2486N probably benign Het
Dnah5 A G 15: 28,408,321 Q3484R probably benign Het
Drd1 T C 13: 54,053,553 Y207C probably damaging Het
Dtl C T 1: 191,558,110 V222I probably damaging Het
Dync1h1 T C 12: 110,640,882 Y2636H probably damaging Het
Endog C A 2: 30,172,036 D154E probably benign Het
Epc1 A T 18: 6,462,954 V14E probably damaging Het
Ercc4 C A 16: 13,147,934 T810K probably damaging Het
Fam43b T A 4: 138,395,988 N7I possibly damaging Het
Fgd1 T C X: 151,086,217 probably null Het
Filip1 G T 9: 79,819,330 T669N probably damaging Het
Fndc1 A G 17: 7,778,665 probably benign Het
Foxk1 C A 5: 142,435,188 S189* probably null Het
Gatm T C 2: 122,600,536 N274S probably damaging Het
Gdf9 A G 11: 53,437,507 Y430C probably damaging Het
Gga1 C T 15: 78,888,448 P260S probably damaging Het
Gm11595 A T 11: 99,772,501 C118S unknown Het
Gm382 G T X: 127,062,651 V820L possibly damaging Het
Gzmk T A 13: 113,172,014 I179F probably damaging Het
Hsp90b1 T C 10: 86,695,706 D421G probably damaging Het
Hus1 A G 11: 9,006,011 M174T probably damaging Het
Ifngr2 T A 16: 91,562,873 Y289* probably null Het
Il6st T A 13: 112,504,175 H828Q probably benign Het
Impg2 T A 16: 56,218,379 Y127N probably damaging Het
Irf3 T A 7: 45,001,744 W345R probably damaging Het
Kif1b G A 4: 149,187,640 S1568L possibly damaging Het
Klhl42 A G 6: 147,101,753 T342A probably benign Het
Kndc1 G T 7: 139,930,112 R1289L probably damaging Het
Knl1 A T 2: 119,071,819 T1334S possibly damaging Het
L3mbtl3 G T 10: 26,313,868 D499E unknown Het
Ldhd T A 8: 111,627,048 M478L probably benign Het
Loxl4 C G 19: 42,603,963 E385D probably damaging Het
Lrriq1 G A 10: 103,214,857 T678I probably benign Het
Macf1 T A 4: 123,492,774 I1017F probably benign Het
Madcam1 A G 10: 79,665,572 E157G possibly damaging Het
Mamdc4 T C 2: 25,569,258 D195G probably damaging Het
Mctp1 A G 13: 76,824,822 D648G probably damaging Het
Mycbp2 T C 14: 103,201,230 M2072V probably benign Het
Nck1 A G 9: 100,497,547 probably null Het
Ndufaf4 G T 4: 24,898,608 D55Y probably damaging Het
Nek11 A T 9: 105,300,361 D230E probably benign Het
Nit2 T C 16: 57,161,196 K67E possibly damaging Het
Olfr2 T C 7: 107,001,248 D204G probably damaging Het
Olfr290 T C 7: 84,916,493 F238S probably damaging Het
Olfr527 C T 7: 140,336,429 T189M probably damaging Het
Olfr802 A T 10: 129,682,532 V69E possibly damaging Het
Pccb G C 9: 100,985,831 D347E probably damaging Het
Plcl1 T A 1: 55,697,838 F779L probably damaging Het
Prune2 C A 19: 17,122,422 D1763E probably benign Het
Pwwp2a A G 11: 43,705,318 S437G probably benign Het
Rabgap1l A T 1: 160,738,957 D90E probably benign Het
Rapgef4 T A 2: 72,226,553 I552N possibly damaging Het
Scn7a A T 2: 66,697,986 I720K probably damaging Het
Scn9a T A 2: 66,526,654 N1101I probably damaging Het
Siglec1 A T 2: 131,080,497 Y553N probably damaging Het
Slc22a23 A G 13: 34,203,970 L381P possibly damaging Het
Slc7a11 T A 3: 50,384,109 T284S probably damaging Het
Slc8a2 T A 7: 16,140,492 probably null Het
Snx29 T A 16: 11,400,971 S224T probably damaging Het
Stox1 T C 10: 62,664,535 T749A probably benign Het
Tg A G 15: 66,694,894 I1264V probably benign Het
Tmem110 T C 14: 30,866,624 Y103H probably damaging Het
Top2a A C 11: 99,009,807 V609G probably damaging Het
Trmt44 G A 5: 35,574,832 P72S probably benign Het
Ttn T C 2: 76,748,678 D23957G probably damaging Het
Ttn G A 2: 76,833,897 probably benign Het
Ubxn1 T G 19: 8,872,070 V59G probably benign Het
Ubxn4 T C 1: 128,244,510 S14P probably benign Het
Uso1 T A 5: 92,195,370 M771K probably benign Het
Utp20 A G 10: 88,814,055 F431S probably damaging Het
Vmn1r206 T C 13: 22,620,612 S142G probably benign Het
Vmn2r19 A G 6: 123,308,330 probably null Het
Vps36 G T 8: 22,218,289 probably null Het
Wnt3 A G 11: 103,812,648 H319R possibly damaging Het
Zbtb26 G T 2: 37,436,551 Q158K probably benign Het
Zfp648 T C 1: 154,204,607 S171P probably benign Het
Other mutations in Ttll3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01338:Ttll3 APN 6 113394729 missense probably damaging 1.00
IGL01677:Ttll3 APN 6 113412984 missense probably benign
IGL01697:Ttll3 APN 6 113399729 missense probably benign 0.00
IGL01944:Ttll3 APN 6 113414115 missense probably benign
IGL02688:Ttll3 APN 6 113399739 missense probably benign 0.00
IGL03068:Ttll3 APN 6 113409197 missense probably damaging 1.00
R0373:Ttll3 UTSW 6 113398777 missense probably damaging 1.00
R0472:Ttll3 UTSW 6 113409339 missense probably damaging 1.00
R0625:Ttll3 UTSW 6 113408903 critical splice acceptor site probably null
R1868:Ttll3 UTSW 6 113392764 missense possibly damaging 0.95
R2026:Ttll3 UTSW 6 113398770 missense probably damaging 1.00
R2061:Ttll3 UTSW 6 113409042 missense possibly damaging 0.76
R2896:Ttll3 UTSW 6 113392722 missense probably benign 0.15
R2903:Ttll3 UTSW 6 113407323 missense probably damaging 0.99
R2906:Ttll3 UTSW 6 113392510 unclassified probably benign
R4659:Ttll3 UTSW 6 113414141 missense probably benign
R4746:Ttll3 UTSW 6 113407392 missense probably damaging 1.00
R4984:Ttll3 UTSW 6 113412940 missense probably benign 0.00
R5358:Ttll3 UTSW 6 113401331 missense probably benign 0.26
R5372:Ttll3 UTSW 6 113401421 nonsense probably null
R5525:Ttll3 UTSW 6 113412978 missense probably benign
R5548:Ttll3 UTSW 6 113393117 missense probably damaging 1.00
R5694:Ttll3 UTSW 6 113399708 missense probably damaging 1.00
R5993:Ttll3 UTSW 6 113398031 nonsense probably null
R6119:Ttll3 UTSW 6 113394741 missense probably damaging 1.00
R6268:Ttll3 UTSW 6 113392563 missense probably benign 0.00
R6719:Ttll3 UTSW 6 113399032 intron probably benign
R6852:Ttll3 UTSW 6 113399155 frame shift probably null
R6852:Ttll3 UTSW 6 113399157 frame shift probably null
R6852:Ttll3 UTSW 6 113399159 frame shift probably null
R6853:Ttll3 UTSW 6 113399157 frame shift probably null
R6854:Ttll3 UTSW 6 113399157 frame shift probably null
R7170:Ttll3 UTSW 6 113413878 missense probably benign 0.41
R7239:Ttll3 UTSW 6 113399157 frame shift probably null
R7302:Ttll3 UTSW 6 113409285 missense probably damaging 1.00
R7330:Ttll3 UTSW 6 113399157 frame shift probably null
R7330:Ttll3 UTSW 6 113399164 frame shift probably null
R7586:Ttll3 UTSW 6 113399157 frame shift probably null
R7587:Ttll3 UTSW 6 113399157 frame shift probably null
R7701:Ttll3 UTSW 6 113399157 frame shift probably null
R7702:Ttll3 UTSW 6 113399157 frame shift probably null
R7776:Ttll3 UTSW 6 113399159 frame shift probably null
R7793:Ttll3 UTSW 6 113399159 frame shift probably null
R7797:Ttll3 UTSW 6 113394777 missense possibly damaging 0.76
R7824:Ttll3 UTSW 6 113399157 frame shift probably null
R7825:Ttll3 UTSW 6 113399157 frame shift probably null
R7825:Ttll3 UTSW 6 113399159 frame shift probably null
R7826:Ttll3 UTSW 6 113399157 frame shift probably null
R7827:Ttll3 UTSW 6 113399157 frame shift probably null
R7827:Ttll3 UTSW 6 113399162 frame shift probably null
R7831:Ttll3 UTSW 6 113399157 frame shift probably null
R7832:Ttll3 UTSW 6 113399157 frame shift probably null
R7833:Ttll3 UTSW 6 113409337 missense probably damaging 1.00
R7966:Ttll3 UTSW 6 113399157 frame shift probably null
R8344:Ttll3 UTSW 6 113394998 missense probably damaging 1.00
R8418:Ttll3 UTSW 6 113394773 missense probably benign 0.04
R8768:Ttll3 UTSW 6 113408988 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGCACTAGTGTCTGAGAC -3'
(R):5'- TTGAAAATGTGGCCCACCCTG -3'

Sequencing Primer
(F):5'- CACTAGTGTCTGAGACGGCCTTG -3'
(R):5'- GTGGCCCACCCTGATGTTTG -3'
Posted On2014-09-17