Incidental Mutation 'R2128:Kndc1'
ID227729
Institutional Source Beutler Lab
Gene Symbol Kndc1
Ensembl Gene ENSMUSG00000066129
Gene Namekinase non-catalytic C-lobe domain (KIND) containing 1
SynonymsB830014K08Rik, 2410012C07Rik, very-kind, VKIND
MMRRC Submission 040131-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2128 (G1)
Quality Score147
Status Not validated
Chromosome7
Chromosomal Location139894696-139941537 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 139930112 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 1289 (R1289L)
Ref Sequence ENSEMBL: ENSMUSP00000050586 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053445]
Predicted Effect probably damaging
Transcript: ENSMUST00000053445
AA Change: R1289L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000050586
Gene: ENSMUSG00000066129
AA Change: R1289L

DomainStartEndE-ValueType
KIND 37 217 4.66e-65 SMART
Blast:KIND 381 454 2e-10 BLAST
KIND 456 620 1.22e-50 SMART
low complexity region 658 670 N/A INTRINSIC
low complexity region 755 771 N/A INTRINSIC
low complexity region 792 801 N/A INTRINSIC
low complexity region 949 965 N/A INTRINSIC
coiled coil region 1121 1151 N/A INTRINSIC
Pfam:RasGEF_N 1242 1341 2.2e-17 PFAM
Pfam:RasGEF 1464 1672 3.8e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154782
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156941
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a Ras guanine nucleotide exchange factor that appears to negatively regulate dendritic growth in the brain. Knockdown of this gene in senescent umbilical vein endothelial cells partially reversed the senescence, showing that this gene could potentially be targeted by anti-aging therapies. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and overtly normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik A G 10: 87,230,204 E249G possibly damaging Het
2610028H24Rik A G 10: 76,457,515 M136V possibly damaging Het
4930523C07Rik A T 1: 160,075,375 K72* probably null Het
Abca6 A G 11: 110,219,649 I558T probably benign Het
Acot10 T C 15: 20,666,626 T10A probably benign Het
Adgrl4 T A 3: 151,500,201 D233E probably benign Het
Adgrv1 A T 13: 81,557,080 F1537Y probably damaging Het
Akap2 A G 4: 57,854,890 Y134C probably benign Het
Aqp3 T A 4: 41,098,061 I17F probably benign Het
Arap1 T A 7: 101,409,320 L1375H probably damaging Het
Aspm T C 1: 139,457,635 V339A probably benign Het
Atp13a3 G A 16: 30,354,276 A261V probably damaging Het
Casp8ap2 T C 4: 32,640,142 Y399H probably benign Het
Cept1 A G 3: 106,512,879 V213A probably damaging Het
Cit A G 5: 115,985,507 D1469G possibly damaging Het
Cnga2 A G X: 72,007,788 Y182C possibly damaging Het
Cox20 A G 1: 178,321,947 I54V probably benign Het
Dhx8 C A 11: 101,738,409 D261E probably benign Het
Dnah2 A T 11: 69,458,185 I2486N probably benign Het
Dnah5 A G 15: 28,408,321 Q3484R probably benign Het
Drd1 T C 13: 54,053,553 Y207C probably damaging Het
Dtl C T 1: 191,558,110 V222I probably damaging Het
Dync1h1 T C 12: 110,640,882 Y2636H probably damaging Het
Endog C A 2: 30,172,036 D154E probably benign Het
Epc1 A T 18: 6,462,954 V14E probably damaging Het
Ercc4 C A 16: 13,147,934 T810K probably damaging Het
Fam43b T A 4: 138,395,988 N7I possibly damaging Het
Fgd1 T C X: 151,086,217 probably null Het
Filip1 G T 9: 79,819,330 T669N probably damaging Het
Fndc1 A G 17: 7,778,665 probably benign Het
Foxk1 C A 5: 142,435,188 S189* probably null Het
Gatm T C 2: 122,600,536 N274S probably damaging Het
Gdf9 A G 11: 53,437,507 Y430C probably damaging Het
Gga1 C T 15: 78,888,448 P260S probably damaging Het
Gm11595 A T 11: 99,772,501 C118S unknown Het
Gm382 G T X: 127,062,651 V820L possibly damaging Het
Gzmk T A 13: 113,172,014 I179F probably damaging Het
Hsp90b1 T C 10: 86,695,706 D421G probably damaging Het
Hus1 A G 11: 9,006,011 M174T probably damaging Het
Ifngr2 T A 16: 91,562,873 Y289* probably null Het
Il6st T A 13: 112,504,175 H828Q probably benign Het
Impg2 T A 16: 56,218,379 Y127N probably damaging Het
Irf3 T A 7: 45,001,744 W345R probably damaging Het
Kif1b G A 4: 149,187,640 S1568L possibly damaging Het
Klhl42 A G 6: 147,101,753 T342A probably benign Het
Knl1 A T 2: 119,071,819 T1334S possibly damaging Het
L3mbtl3 G T 10: 26,313,868 D499E unknown Het
Ldhd T A 8: 111,627,048 M478L probably benign Het
Loxl4 C G 19: 42,603,963 E385D probably damaging Het
Lrriq1 G A 10: 103,214,857 T678I probably benign Het
Macf1 T A 4: 123,492,774 I1017F probably benign Het
Madcam1 A G 10: 79,665,572 E157G possibly damaging Het
Mamdc4 T C 2: 25,569,258 D195G probably damaging Het
Mctp1 A G 13: 76,824,822 D648G probably damaging Het
Mycbp2 T C 14: 103,201,230 M2072V probably benign Het
Nck1 A G 9: 100,497,547 probably null Het
Ndufaf4 G T 4: 24,898,608 D55Y probably damaging Het
Nek11 A T 9: 105,300,361 D230E probably benign Het
Nit2 T C 16: 57,161,196 K67E possibly damaging Het
Olfr2 T C 7: 107,001,248 D204G probably damaging Het
Olfr290 T C 7: 84,916,493 F238S probably damaging Het
Olfr527 C T 7: 140,336,429 T189M probably damaging Het
Olfr802 A T 10: 129,682,532 V69E possibly damaging Het
Pccb G C 9: 100,985,831 D347E probably damaging Het
Plcl1 T A 1: 55,697,838 F779L probably damaging Het
Prune2 C A 19: 17,122,422 D1763E probably benign Het
Pwwp2a A G 11: 43,705,318 S437G probably benign Het
Rabgap1l A T 1: 160,738,957 D90E probably benign Het
Rapgef4 T A 2: 72,226,553 I552N possibly damaging Het
Scn7a A T 2: 66,697,986 I720K probably damaging Het
Scn9a T A 2: 66,526,654 N1101I probably damaging Het
Siglec1 A T 2: 131,080,497 Y553N probably damaging Het
Slc22a23 A G 13: 34,203,970 L381P possibly damaging Het
Slc7a11 T A 3: 50,384,109 T284S probably damaging Het
Slc8a2 T A 7: 16,140,492 probably null Het
Snx29 T A 16: 11,400,971 S224T probably damaging Het
Stox1 T C 10: 62,664,535 T749A probably benign Het
Tg A G 15: 66,694,894 I1264V probably benign Het
Tmem110 T C 14: 30,866,624 Y103H probably damaging Het
Top2a A C 11: 99,009,807 V609G probably damaging Het
Trmt44 G A 5: 35,574,832 P72S probably benign Het
Ttll3 G C 6: 113,412,934 S760T probably benign Het
Ttn T C 2: 76,748,678 D23957G probably damaging Het
Ttn G A 2: 76,833,897 probably benign Het
Ubxn1 T G 19: 8,872,070 V59G probably benign Het
Ubxn4 T C 1: 128,244,510 S14P probably benign Het
Uso1 T A 5: 92,195,370 M771K probably benign Het
Utp20 A G 10: 88,814,055 F431S probably damaging Het
Vmn1r206 T C 13: 22,620,612 S142G probably benign Het
Vmn2r19 A G 6: 123,308,330 probably null Het
Vps36 G T 8: 22,218,289 probably null Het
Wnt3 A G 11: 103,812,648 H319R possibly damaging Het
Zbtb26 G T 2: 37,436,551 Q158K probably benign Het
Zfp648 T C 1: 154,204,607 S171P probably benign Het
Other mutations in Kndc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Kndc1 APN 7 139901988 splice site probably benign
IGL01061:Kndc1 APN 7 139922694 missense probably benign 0.00
IGL01099:Kndc1 APN 7 139920784 missense probably damaging 1.00
IGL01522:Kndc1 APN 7 139913972 splice site probably benign
IGL01767:Kndc1 APN 7 139930046 missense probably damaging 1.00
IGL01884:Kndc1 APN 7 139914194 missense probably damaging 1.00
IGL01932:Kndc1 APN 7 139923790 missense probably damaging 0.98
IGL02133:Kndc1 APN 7 139920767 missense probably benign 0.19
IGL02411:Kndc1 APN 7 139921913 critical splice donor site probably null
IGL02472:Kndc1 APN 7 139910901 missense probably benign 0.01
IGL02537:Kndc1 APN 7 139910410 missense probably benign 0.01
IGL02708:Kndc1 APN 7 139901181 missense probably damaging 1.00
IGL03115:Kndc1 APN 7 139921509 missense probably benign 0.28
IGL03160:Kndc1 APN 7 139920689 nonsense probably null
IGL03138:Kndc1 UTSW 7 139939878 missense possibly damaging 0.89
PIT4142001:Kndc1 UTSW 7 139923776 frame shift probably null
PIT4696001:Kndc1 UTSW 7 139932917 missense probably damaging 1.00
R0349:Kndc1 UTSW 7 139910304 missense probably benign 0.00
R0384:Kndc1 UTSW 7 139910599 missense possibly damaging 0.85
R0415:Kndc1 UTSW 7 139930124 missense probably damaging 1.00
R0421:Kndc1 UTSW 7 139908996 missense probably damaging 1.00
R0487:Kndc1 UTSW 7 139914023 missense probably null 0.19
R0530:Kndc1 UTSW 7 139901237 missense probably damaging 1.00
R0905:Kndc1 UTSW 7 139923735 missense possibly damaging 0.94
R1434:Kndc1 UTSW 7 139922684 missense probably damaging 1.00
R1608:Kndc1 UTSW 7 139927408 missense possibly damaging 0.80
R1644:Kndc1 UTSW 7 139930756 missense probably damaging 1.00
R1835:Kndc1 UTSW 7 139927711 missense probably damaging 0.99
R2012:Kndc1 UTSW 7 139921280 missense possibly damaging 0.90
R2102:Kndc1 UTSW 7 139930761 missense probably benign 0.02
R2103:Kndc1 UTSW 7 139921234 missense probably benign 0.01
R2516:Kndc1 UTSW 7 139921822 missense probably damaging 1.00
R3030:Kndc1 UTSW 7 139901207 missense probably damaging 1.00
R3617:Kndc1 UTSW 7 139902060 splice site probably benign
R3747:Kndc1 UTSW 7 139927904 critical splice donor site probably null
R3848:Kndc1 UTSW 7 139908977 missense probably damaging 1.00
R4028:Kndc1 UTSW 7 139930028 missense probably damaging 0.98
R4043:Kndc1 UTSW 7 139924129 missense probably benign 0.06
R4044:Kndc1 UTSW 7 139924129 missense probably benign 0.06
R4095:Kndc1 UTSW 7 139937025 missense possibly damaging 0.49
R4289:Kndc1 UTSW 7 139910882 missense probably benign 0.01
R4478:Kndc1 UTSW 7 139920684 missense probably damaging 1.00
R4514:Kndc1 UTSW 7 139910286 missense probably benign 0.00
R4540:Kndc1 UTSW 7 139921427 nonsense probably null
R4584:Kndc1 UTSW 7 139901243 missense probably damaging 1.00
R4693:Kndc1 UTSW 7 139921779 missense probably benign 0.02
R4705:Kndc1 UTSW 7 139930123 missense possibly damaging 0.81
R4773:Kndc1 UTSW 7 139924031 nonsense probably null
R4859:Kndc1 UTSW 7 139921905 missense probably benign 0.03
R5004:Kndc1 UTSW 7 139932879 nonsense probably null
R5037:Kndc1 UTSW 7 139910455 missense possibly damaging 0.52
R5322:Kndc1 UTSW 7 139936809 missense probably damaging 1.00
R5428:Kndc1 UTSW 7 139908962 missense probably damaging 0.99
R5503:Kndc1 UTSW 7 139931889 missense probably damaging 1.00
R5506:Kndc1 UTSW 7 139927891 missense probably damaging 1.00
R5525:Kndc1 UTSW 7 139924111 missense probably benign 0.00
R5888:Kndc1 UTSW 7 139895217 missense probably benign 0.00
R5942:Kndc1 UTSW 7 139936879 missense probably damaging 1.00
R5979:Kndc1 UTSW 7 139939827 missense probably benign 0.05
R5990:Kndc1 UTSW 7 139927420 missense probably damaging 0.99
R6038:Kndc1 UTSW 7 139923775 frame shift probably null
R6076:Kndc1 UTSW 7 139902038 missense probably damaging 1.00
R6118:Kndc1 UTSW 7 139923802 missense probably damaging 1.00
R6151:Kndc1 UTSW 7 139921213 missense probably benign 0.04
R6276:Kndc1 UTSW 7 139921063 missense probably benign
R6367:Kndc1 UTSW 7 139913506 missense probably damaging 1.00
R6726:Kndc1 UTSW 7 139922751 critical splice donor site probably null
R6745:Kndc1 UTSW 7 139920976 missense probably benign 0.02
R6886:Kndc1 UTSW 7 139913569 missense probably benign 0.01
R6912:Kndc1 UTSW 7 139910278 missense probably damaging 0.99
R7070:Kndc1 UTSW 7 139921828 missense probably damaging 1.00
R7123:Kndc1 UTSW 7 139936836 missense probably damaging 0.99
R7158:Kndc1 UTSW 7 139931860 missense possibly damaging 0.48
R7248:Kndc1 UTSW 7 139920783 missense probably damaging 1.00
R7437:Kndc1 UTSW 7 139909043 missense probably damaging 1.00
R7564:Kndc1 UTSW 7 139920696 missense probably benign 0.01
R7570:Kndc1 UTSW 7 139923775 frame shift probably null
R7625:Kndc1 UTSW 7 139938017 missense possibly damaging 0.90
R7629:Kndc1 UTSW 7 139895260 missense probably damaging 1.00
R7726:Kndc1 UTSW 7 139939838 missense possibly damaging 0.67
R7840:Kndc1 UTSW 7 139923816 missense probably damaging 1.00
R7859:Kndc1 UTSW 7 139920964 missense possibly damaging 0.57
R7923:Kndc1 UTSW 7 139923816 missense probably damaging 1.00
R7942:Kndc1 UTSW 7 139920964 missense possibly damaging 0.57
R8011:Kndc1 UTSW 7 139910620 missense possibly damaging 0.90
R8062:Kndc1 UTSW 7 139918844 missense probably benign 0.01
Z1177:Kndc1 UTSW 7 139921912 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- ACAGGCACGCTCACTCATTG -3'
(R):5'- CCCTGCTTTCTTGAGGAAGG -3'

Sequencing Primer
(F):5'- ACGCTCACTCATTGCTGGG -3'
(R):5'- AAGCAGTAAGGGCCCTTCCAG -3'
Posted On2014-09-17