Incidental Mutation 'R0152:Olfr1331'
ID22773
Institutional Source Beutler Lab
Gene Symbol Olfr1331
Ensembl Gene ENSMUSG00000073769
Gene Nameolfactory receptor 1331
SynonymsMOR259-3P, GA_x6K02T2QD9B-18670866-18669913
MMRRC Submission 038435-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock #R0152 (G1)
Quality Score225
Status Validated (trace)
Chromosome4
Chromosomal Location118864649-118871707 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 118868886 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 34 (I34N)
Ref Sequence ENSEMBL: ENSMUSP00000154685 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094831] [ENSMUST00000106360] [ENSMUST00000216589]
Predicted Effect possibly damaging
Transcript: ENSMUST00000094831
AA Change: I35N

PolyPhen 2 Score 0.794 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000092426
Gene: ENSMUSG00000073769
AA Change: I35N

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 2.1e-53 PFAM
Pfam:7tm_1 42 291 3.9e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000106360
AA Change: I35N

PolyPhen 2 Score 0.794 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000101967
Gene: ENSMUSG00000073769
AA Change: I35N

DomainStartEndE-ValueType
Pfam:7tm_1 41 290 1.2e-28 PFAM
Pfam:7tm_4 139 283 2.8e-45 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000216589
AA Change: I34N

PolyPhen 2 Score 0.887 (Sensitivity: 0.82; Specificity: 0.94)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.3%
  • 20x: 89.5%
Validation Efficiency 87% (40/46)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass T C 6: 23,074,689 D834G probably damaging Het
Abca13 T A 11: 9,581,724 H4650Q probably damaging Het
Aqr T A 2: 114,159,010 T111S probably benign Het
Arfip2 G A 7: 105,637,223 T124M probably damaging Het
Arhgap44 G T 11: 65,011,919 A574E probably benign Het
Arhgef26 T C 3: 62,423,544 S560P probably damaging Het
Car5a T A 8: 121,916,446 N273I probably damaging Het
Cd4 G A 6: 124,867,746 Q359* probably null Het
Cgrrf1 G A 14: 46,853,913 C298Y probably damaging Het
Clip3 G A 7: 30,303,432 A416T probably benign Het
Dst C T 1: 34,189,119 P1606L probably damaging Het
Eif3e G A 15: 43,252,236 A378V possibly damaging Het
Ercc6 C G 14: 32,546,905 probably benign Het
Eri2 A G 7: 119,790,383 V104A probably damaging Het
Exph5 T A 9: 53,353,204 probably null Het
Hmcn1 A T 1: 150,663,879 Y2954N probably benign Het
Itga2 C T 13: 114,866,314 G547R probably benign Het
Kbtbd11 T C 8: 15,027,428 V9A probably damaging Het
Ldb2 T C 5: 44,541,799 D99G possibly damaging Het
Mfsd12 G T 10: 81,357,799 D68Y probably damaging Het
Mgarp T C 3: 51,388,963 D228G probably benign Het
Myh14 A T 7: 44,623,181 L1441Q probably damaging Het
Obscn T C 11: 59,052,576 D4810G probably benign Het
Olfr1448 A G 19: 12,920,108 V67A possibly damaging Het
Olfr293 A T 7: 86,664,511 Y283F probably damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr948 A G 9: 39,319,461 I51T probably benign Het
Pdhx A G 2: 103,028,280 V393A probably benign Het
Pdpk1 C T 17: 24,106,946 R92H possibly damaging Het
Pgr A T 9: 8,965,022 I889F probably benign Het
Pum2 T A 12: 8,728,754 I468K possibly damaging Het
Recql5 A G 11: 115,894,673 S666P probably benign Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc26a4 T C 12: 31,529,498 I588M probably damaging Het
Slc9a2 A G 1: 40,742,804 T398A probably damaging Het
Snapc1 C T 12: 73,975,032 R81C probably damaging Het
Tub A T 7: 109,020,927 N93Y probably damaging Het
Usp3 T C 9: 66,540,150 T181A probably damaging Het
Vars2 A G 17: 35,660,027 L637P probably damaging Het
Vmn2r1 T C 3: 64,081,819 S60P possibly damaging Het
Wdcp A G 12: 4,851,583 S480G probably benign Het
Zbtb38 T C 9: 96,686,280 Y917C probably damaging Het
Zfp68 T C 5: 138,606,613 K445E probably damaging Het
Zmynd10 A G 9: 107,550,945 probably null Het
Other mutations in Olfr1331
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Olfr1331 APN 4 118869287 missense probably damaging 1.00
IGL01314:Olfr1331 APN 4 118869131 missense probably benign 0.26
IGL02025:Olfr1331 APN 4 118869165 missense probably damaging 1.00
IGL02458:Olfr1331 APN 4 118869300 missense possibly damaging 0.83
IGL02793:Olfr1331 APN 4 118869597 missense probably damaging 1.00
IGL02827:Olfr1331 APN 4 118868960 missense probably damaging 0.99
IGL02863:Olfr1331 APN 4 118868886 missense possibly damaging 0.52
IGL03125:Olfr1331 APN 4 118868921 missense possibly damaging 0.95
R0078:Olfr1331 UTSW 4 118869227 missense probably benign
R0299:Olfr1331 UTSW 4 118869416 missense probably benign 0.00
R3881:Olfr1331 UTSW 4 118869353 missense probably benign 0.00
R3928:Olfr1331 UTSW 4 118868982 missense probably damaging 1.00
R3929:Olfr1331 UTSW 4 118868982 missense probably damaging 1.00
R5288:Olfr1331 UTSW 4 118869575 missense probably damaging 1.00
R5552:Olfr1331 UTSW 4 118869468 missense probably damaging 1.00
R5672:Olfr1331 UTSW 4 118869182 missense possibly damaging 0.83
R5773:Olfr1331 UTSW 4 118869521 missense probably damaging 0.97
R6117:Olfr1331 UTSW 4 118869144 missense probably benign 0.39
R6910:Olfr1331 UTSW 4 118869138 missense probably damaging 1.00
R6911:Olfr1331 UTSW 4 118869138 missense probably damaging 1.00
R6912:Olfr1331 UTSW 4 118869138 missense probably damaging 1.00
R7164:Olfr1331 UTSW 4 118869725 missense probably benign 0.30
R7446:Olfr1331 UTSW 4 118868822 missense possibly damaging 0.83
T0975:Olfr1331 UTSW 4 118869303 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ACCAATCTTCTGGGCTGCACTG -3'
(R):5'- ATGCAAGCCAAGCTACGCACTG -3'

Sequencing Primer
(F):5'- CTGCACTGTTTCAGGTGTTAC -3'
(R):5'- GACCTTCACACAAGTAGTGGTTG -3'
Posted On2013-04-16