Incidental Mutation 'R0152:Ldb2'
ID22774
Institutional Source Beutler Lab
Gene Symbol Ldb2
Ensembl Gene ENSMUSG00000039706
Gene NameLIM domain binding 2
SynonymsCLIM1, CLP-36, Ldb3, CLIM-1b, CLIM-1a
MMRRC Submission 038435-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0152 (G1)
Quality Score225
Status Validated (trace)
Chromosome5
Chromosomal Location44472132-44799680 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 44541799 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 99 (D99G)
Ref Sequence ENSEMBL: ENSMUSP00000142442 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070748] [ENSMUST00000199256] [ENSMUST00000199261] [ENSMUST00000199534]
Predicted Effect possibly damaging
Transcript: ENSMUST00000070748
AA Change: D99G

PolyPhen 2 Score 0.860 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000067737
Gene: ENSMUSG00000039706
AA Change: D99G

DomainStartEndE-ValueType
Pfam:LIM_bind 30 232 9.9e-56 PFAM
low complexity region 249 281 N/A INTRINSIC
PDB:2JTN|A 293 337 2e-21 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198894
Predicted Effect possibly damaging
Transcript: ENSMUST00000199256
AA Change: D99G

PolyPhen 2 Score 0.860 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000143775
Gene: ENSMUSG00000039706
AA Change: D99G

DomainStartEndE-ValueType
Pfam:LIM_bind 30 232 6.9e-56 PFAM
low complexity region 249 281 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000199261
AA Change: D99G

PolyPhen 2 Score 0.846 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000143289
Gene: ENSMUSG00000039706
AA Change: D99G

DomainStartEndE-ValueType
Pfam:LIM_bind 29 233 2.3e-68 PFAM
low complexity region 249 281 N/A INTRINSIC
PDB:2YPA|D 296 335 2e-20 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199471
Predicted Effect possibly damaging
Transcript: ENSMUST00000199534
AA Change: D99G

PolyPhen 2 Score 0.860 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000142442
Gene: ENSMUSG00000039706
AA Change: D99G

DomainStartEndE-ValueType
Pfam:LIM_bind 29 233 2e-71 PFAM
low complexity region 249 281 N/A INTRINSIC
Meta Mutation Damage Score 0.1233 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.3%
  • 20x: 89.5%
Validation Efficiency 87% (40/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the LIM-domain binding family. Members of this family are characterized by a conserved nuclear localization sequence, an amino-terminal homodimerization domain and a carboxy-terminal LIM interaction domain. These proteins function as adapter molecules to allow assembly of transcriptional regulatory complexes. Genetic association studies suggest functions for this gene in rhegmatogenous retinal detachment and coronary artery disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]
PHENOTYPE: Homozygous mutation of this gene results in no obvious phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass T C 6: 23,074,689 D834G probably damaging Het
Abca13 T A 11: 9,581,724 H4650Q probably damaging Het
Aqr T A 2: 114,159,010 T111S probably benign Het
Arfip2 G A 7: 105,637,223 T124M probably damaging Het
Arhgap44 G T 11: 65,011,919 A574E probably benign Het
Arhgef26 T C 3: 62,423,544 S560P probably damaging Het
Car5a T A 8: 121,916,446 N273I probably damaging Het
Cd4 G A 6: 124,867,746 Q359* probably null Het
Cgrrf1 G A 14: 46,853,913 C298Y probably damaging Het
Clip3 G A 7: 30,303,432 A416T probably benign Het
Dst C T 1: 34,189,119 P1606L probably damaging Het
Eif3e G A 15: 43,252,236 A378V possibly damaging Het
Ercc6 C G 14: 32,546,905 probably benign Het
Eri2 A G 7: 119,790,383 V104A probably damaging Het
Exph5 T A 9: 53,353,204 probably null Het
Hmcn1 A T 1: 150,663,879 Y2954N probably benign Het
Itga2 C T 13: 114,866,314 G547R probably benign Het
Kbtbd11 T C 8: 15,027,428 V9A probably damaging Het
Mfsd12 G T 10: 81,357,799 D68Y probably damaging Het
Mgarp T C 3: 51,388,963 D228G probably benign Het
Myh14 A T 7: 44,623,181 L1441Q probably damaging Het
Obscn T C 11: 59,052,576 D4810G probably benign Het
Olfr1331 T A 4: 118,868,886 I34N possibly damaging Het
Olfr1448 A G 19: 12,920,108 V67A possibly damaging Het
Olfr293 A T 7: 86,664,511 Y283F probably damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr948 A G 9: 39,319,461 I51T probably benign Het
Pdhx A G 2: 103,028,280 V393A probably benign Het
Pdpk1 C T 17: 24,106,946 R92H possibly damaging Het
Pgr A T 9: 8,965,022 I889F probably benign Het
Pum2 T A 12: 8,728,754 I468K possibly damaging Het
Recql5 A G 11: 115,894,673 S666P probably benign Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc26a4 T C 12: 31,529,498 I588M probably damaging Het
Slc9a2 A G 1: 40,742,804 T398A probably damaging Het
Snapc1 C T 12: 73,975,032 R81C probably damaging Het
Tub A T 7: 109,020,927 N93Y probably damaging Het
Usp3 T C 9: 66,540,150 T181A probably damaging Het
Vars2 A G 17: 35,660,027 L637P probably damaging Het
Vmn2r1 T C 3: 64,081,819 S60P possibly damaging Het
Wdcp A G 12: 4,851,583 S480G probably benign Het
Zbtb38 T C 9: 96,686,280 Y917C probably damaging Het
Zfp68 T C 5: 138,606,613 K445E probably damaging Het
Zmynd10 A G 9: 107,550,945 probably null Het
Other mutations in Ldb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Ldb2 APN 5 44541684 splice site probably null
IGL01757:Ldb2 APN 5 44541867 splice site probably benign
IGL01936:Ldb2 APN 5 44480244 missense probably damaging 1.00
IGL03105:Ldb2 APN 5 44799373 missense possibly damaging 0.70
IGL03108:Ldb2 APN 5 44541715 missense probably damaging 1.00
R0178:Ldb2 UTSW 5 44473499 missense probably damaging 1.00
R0841:Ldb2 UTSW 5 44532674 missense probably damaging 1.00
R1145:Ldb2 UTSW 5 44532674 missense probably damaging 1.00
R1145:Ldb2 UTSW 5 44532674 missense probably damaging 1.00
R1318:Ldb2 UTSW 5 44535037 critical splice donor site probably null
R1607:Ldb2 UTSW 5 44473472 missense probably damaging 0.99
R2863:Ldb2 UTSW 5 44480324 missense probably damaging 0.99
R3803:Ldb2 UTSW 5 44473394 missense probably benign 0.38
R4502:Ldb2 UTSW 5 44669407 missense probably damaging 1.00
R4613:Ldb2 UTSW 5 44476551 missense probably benign 0.27
R4985:Ldb2 UTSW 5 44480303 missense probably damaging 1.00
R5475:Ldb2 UTSW 5 44541832 missense probably damaging 1.00
R5512:Ldb2 UTSW 5 44480244 missense probably damaging 1.00
R6058:Ldb2 UTSW 5 44476563 missense possibly damaging 0.66
R6282:Ldb2 UTSW 5 44532665 missense probably damaging 1.00
R6438:Ldb2 UTSW 5 44480310 missense probably damaging 0.98
R6770:Ldb2 UTSW 5 44669396 missense probably damaging 0.99
R6830:Ldb2 UTSW 5 44541857 missense probably damaging 1.00
R8061:Ldb2 UTSW 5 44480270 missense probably damaging 1.00
X0026:Ldb2 UTSW 5 44532728 missense probably damaging 0.99
X0028:Ldb2 UTSW 5 44541794 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GACCACGAGGGAGCAACCTTTAATC -3'
(R):5'- GGACATAAACCTCCGTGAGATGGTG -3'

Sequencing Primer
(F):5'- GAGGGAGCAACCTTTAATCTTTAGC -3'
(R):5'- ACTTTCAACCCAGATGGGTC -3'
Posted On2013-04-16