Incidental Mutation 'R2128:Lrriq1'
ID 227746
Institutional Source Beutler Lab
Gene Symbol Lrriq1
Ensembl Gene ENSMUSG00000019892
Gene Name leucine-rich repeats and IQ motif containing 1
Synonyms Gm1557, LOC380658, 4930503E15Rik
MMRRC Submission 040131-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.079) question?
Stock # R2128 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 102881892-103072183 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 103050718 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 678 (T678I)
Ref Sequence ENSEMBL: ENSMUSP00000131419 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020043] [ENSMUST00000123364] [ENSMUST00000166240]
AlphaFold Q0P5X1
Predicted Effect probably benign
Transcript: ENSMUST00000020043
AA Change: T678I

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000020043
Gene: ENSMUSG00000019892
AA Change: T678I

DomainStartEndE-ValueType
coiled coil region 11 31 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
coiled coil region 183 286 N/A INTRINSIC
Blast:IQ 290 312 1e-6 BLAST
coiled coil region 314 390 N/A INTRINSIC
low complexity region 550 559 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123364
SMART Domains Protein: ENSMUSP00000119783
Gene: ENSMUSG00000019892

DomainStartEndE-ValueType
coiled coil region 11 31 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
coiled coil region 183 286 N/A INTRINSIC
Blast:IQ 290 312 6e-6 BLAST
coiled coil region 314 390 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166240
AA Change: T678I

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000131419
Gene: ENSMUSG00000019892
AA Change: T678I

DomainStartEndE-ValueType
coiled coil region 11 31 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
coiled coil region 183 286 N/A INTRINSIC
IQ 290 312 9.78e1 SMART
coiled coil region 314 390 N/A INTRINSIC
low complexity region 550 559 N/A INTRINSIC
LRR 873 894 2.14e1 SMART
LRR 895 917 4.45e1 SMART
LRR 984 1005 2.03e2 SMART
LRR 1029 1052 3.65e0 SMART
low complexity region 1244 1258 N/A INTRINSIC
IQ 1279 1301 5.61e1 SMART
IQ 1339 1361 6.7e-3 SMART
low complexity region 1369 1394 N/A INTRINSIC
low complexity region 1502 1518 N/A INTRINSIC
low complexity region 1528 1543 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220380
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik A G 10: 87,066,066 (GRCm39) E249G possibly damaging Het
2610028H24Rik A G 10: 76,293,349 (GRCm39) M136V possibly damaging Het
4930523C07Rik A T 1: 159,902,945 (GRCm39) K72* probably null Het
Abca6 A G 11: 110,110,475 (GRCm39) I558T probably benign Het
Acot10 T C 15: 20,666,712 (GRCm39) T10A probably benign Het
Adgrl4 T A 3: 151,205,838 (GRCm39) D233E probably benign Het
Adgrv1 A T 13: 81,705,199 (GRCm39) F1537Y probably damaging Het
Aqp3 T A 4: 41,098,061 (GRCm39) I17F probably benign Het
Arap1 T A 7: 101,058,527 (GRCm39) L1375H probably damaging Het
Aspm T C 1: 139,385,373 (GRCm39) V339A probably benign Het
Atp13a3 G A 16: 30,173,094 (GRCm39) A261V probably damaging Het
Casp8ap2 T C 4: 32,640,142 (GRCm39) Y399H probably benign Het
Cept1 A G 3: 106,420,195 (GRCm39) V213A probably damaging Het
Cit A G 5: 116,123,566 (GRCm39) D1469G possibly damaging Het
Cnga2 A G X: 71,051,394 (GRCm39) Y182C possibly damaging Het
Cox20 A G 1: 178,149,512 (GRCm39) I54V probably benign Het
Dhx8 C A 11: 101,629,235 (GRCm39) D261E probably benign Het
Dnah2 A T 11: 69,349,011 (GRCm39) I2486N probably benign Het
Dnah5 A G 15: 28,408,467 (GRCm39) Q3484R probably benign Het
Drd1 T C 13: 54,207,572 (GRCm39) Y207C probably damaging Het
Dtl C T 1: 191,290,222 (GRCm39) V222I probably damaging Het
Dync1h1 T C 12: 110,607,316 (GRCm39) Y2636H probably damaging Het
Endog C A 2: 30,062,048 (GRCm39) D154E probably benign Het
Epc1 A T 18: 6,462,954 (GRCm39) V14E probably damaging Het
Ercc4 C A 16: 12,965,798 (GRCm39) T810K probably damaging Het
Fam43b T A 4: 138,123,299 (GRCm39) N7I possibly damaging Het
Fgd1 T C X: 149,869,213 (GRCm39) probably null Het
Filip1 G T 9: 79,726,612 (GRCm39) T669N probably damaging Het
Fndc1 A G 17: 7,997,497 (GRCm39) probably benign Het
Foxk1 C A 5: 142,420,943 (GRCm39) S189* probably null Het
Gatm T C 2: 122,431,017 (GRCm39) N274S probably damaging Het
Gdf9 A G 11: 53,328,334 (GRCm39) Y430C probably damaging Het
Gga1 C T 15: 78,772,648 (GRCm39) P260S probably damaging Het
Gm11595 A T 11: 99,663,327 (GRCm39) C118S unknown Het
Gm382 G T X: 125,970,274 (GRCm39) V820L possibly damaging Het
Gzmk T A 13: 113,308,548 (GRCm39) I179F probably damaging Het
Hsp90b1 T C 10: 86,531,570 (GRCm39) D421G probably damaging Het
Hus1 A G 11: 8,956,011 (GRCm39) M174T probably damaging Het
Ifngr2 T A 16: 91,359,761 (GRCm39) Y289* probably null Het
Il6st T A 13: 112,640,709 (GRCm39) H828Q probably benign Het
Impg2 T A 16: 56,038,742 (GRCm39) Y127N probably damaging Het
Irf3 T A 7: 44,651,168 (GRCm39) W345R probably damaging Het
Kif1b G A 4: 149,272,097 (GRCm39) S1568L possibly damaging Het
Klhl42 A G 6: 147,003,251 (GRCm39) T342A probably benign Het
Kndc1 G T 7: 139,510,025 (GRCm39) R1289L probably damaging Het
Knl1 A T 2: 118,902,300 (GRCm39) T1334S possibly damaging Het
L3mbtl3 G T 10: 26,189,766 (GRCm39) D499E unknown Het
Ldhd T A 8: 112,353,680 (GRCm39) M478L probably benign Het
Loxl4 C G 19: 42,592,402 (GRCm39) E385D probably damaging Het
Macf1 T A 4: 123,386,567 (GRCm39) I1017F probably benign Het
Madcam1 A G 10: 79,501,406 (GRCm39) E157G possibly damaging Het
Mamdc4 T C 2: 25,459,270 (GRCm39) D195G probably damaging Het
Mctp1 A G 13: 76,972,941 (GRCm39) D648G probably damaging Het
Mycbp2 T C 14: 103,438,666 (GRCm39) M2072V probably benign Het
Nck1 A G 9: 100,379,600 (GRCm39) probably null Het
Ndufaf4 G T 4: 24,898,608 (GRCm39) D55Y probably damaging Het
Nek11 A T 9: 105,177,560 (GRCm39) D230E probably benign Het
Nit2 T C 16: 56,981,559 (GRCm39) K67E possibly damaging Het
Or12j2 C T 7: 139,916,342 (GRCm39) T189M probably damaging Het
Or5ae1 T C 7: 84,565,701 (GRCm39) F238S probably damaging Het
Or6a2 T C 7: 106,600,455 (GRCm39) D204G probably damaging Het
Or6c1 A T 10: 129,518,401 (GRCm39) V69E possibly damaging Het
Pakap A G 4: 57,854,890 (GRCm39) Y134C probably benign Het
Pccb G C 9: 100,867,884 (GRCm39) D347E probably damaging Het
Plcl1 T A 1: 55,736,997 (GRCm39) F779L probably damaging Het
Prune2 C A 19: 17,099,786 (GRCm39) D1763E probably benign Het
Pwwp2a A G 11: 43,596,145 (GRCm39) S437G probably benign Het
Rabgap1l A T 1: 160,566,527 (GRCm39) D90E probably benign Het
Rapgef4 T A 2: 72,056,897 (GRCm39) I552N possibly damaging Het
Scn7a A T 2: 66,528,330 (GRCm39) I720K probably damaging Het
Scn9a T A 2: 66,356,998 (GRCm39) N1101I probably damaging Het
Siglec1 A T 2: 130,922,417 (GRCm39) Y553N probably damaging Het
Slc22a23 A G 13: 34,387,953 (GRCm39) L381P possibly damaging Het
Slc7a11 T A 3: 50,338,558 (GRCm39) T284S probably damaging Het
Slc8a2 T A 7: 15,874,417 (GRCm39) probably null Het
Snx29 T A 16: 11,218,835 (GRCm39) S224T probably damaging Het
Stimate T C 14: 30,588,581 (GRCm39) Y103H probably damaging Het
Stox1 T C 10: 62,500,314 (GRCm39) T749A probably benign Het
Tg A G 15: 66,566,743 (GRCm39) I1264V probably benign Het
Top2a A C 11: 98,900,633 (GRCm39) V609G probably damaging Het
Trmt44 G A 5: 35,732,176 (GRCm39) P72S probably benign Het
Ttll3 G C 6: 113,389,895 (GRCm39) S760T probably benign Het
Ttn T C 2: 76,579,022 (GRCm39) D23957G probably damaging Het
Ttn G A 2: 76,664,241 (GRCm39) probably benign Het
Ubxn1 T G 19: 8,849,434 (GRCm39) V59G probably benign Het
Ubxn4 T C 1: 128,172,247 (GRCm39) S14P probably benign Het
Uso1 T A 5: 92,343,229 (GRCm39) M771K probably benign Het
Utp20 A G 10: 88,649,917 (GRCm39) F431S probably damaging Het
Vmn1r206 T C 13: 22,804,782 (GRCm39) S142G probably benign Het
Vmn2r19 A G 6: 123,285,289 (GRCm39) probably null Het
Vps36 G T 8: 22,708,305 (GRCm39) probably null Het
Wnt3 A G 11: 103,703,474 (GRCm39) H319R possibly damaging Het
Zbtb26 G T 2: 37,326,563 (GRCm39) Q158K probably benign Het
Zfp648 T C 1: 154,080,353 (GRCm39) S171P probably benign Het
Other mutations in Lrriq1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00988:Lrriq1 APN 10 102,997,757 (GRCm39) missense probably damaging 0.99
IGL01523:Lrriq1 APN 10 103,053,977 (GRCm39) nonsense probably null
IGL01637:Lrriq1 APN 10 103,051,489 (GRCm39) missense probably benign
IGL02019:Lrriq1 APN 10 103,014,661 (GRCm39) missense probably benign 0.02
IGL02153:Lrriq1 APN 10 103,006,340 (GRCm39) missense probably benign 0.01
IGL02341:Lrriq1 APN 10 103,060,802 (GRCm39) missense probably benign 0.03
IGL02343:Lrriq1 APN 10 103,070,024 (GRCm39) splice site probably benign
IGL02408:Lrriq1 APN 10 102,982,142 (GRCm39) missense probably benign 0.17
IGL02431:Lrriq1 APN 10 103,036,500 (GRCm39) missense probably damaging 1.00
IGL02540:Lrriq1 APN 10 103,050,880 (GRCm39) missense probably benign 0.02
IGL02558:Lrriq1 APN 10 102,982,144 (GRCm39) missense probably damaging 1.00
IGL02613:Lrriq1 APN 10 102,980,409 (GRCm39) missense probably damaging 0.99
IGL02642:Lrriq1 APN 10 103,057,322 (GRCm39) critical splice acceptor site probably null
IGL03027:Lrriq1 APN 10 103,063,057 (GRCm39) missense probably benign 0.35
PIT4362001:Lrriq1 UTSW 10 102,907,055 (GRCm39) missense probably benign 0.26
R0050:Lrriq1 UTSW 10 102,904,792 (GRCm39) missense probably damaging 0.99
R0050:Lrriq1 UTSW 10 102,904,792 (GRCm39) missense probably damaging 0.99
R0068:Lrriq1 UTSW 10 102,899,279 (GRCm39) missense probably benign 0.02
R0068:Lrriq1 UTSW 10 102,899,279 (GRCm39) missense probably benign 0.02
R0124:Lrriq1 UTSW 10 103,006,281 (GRCm39) critical splice donor site probably null
R0244:Lrriq1 UTSW 10 103,051,634 (GRCm39) missense probably damaging 0.98
R0323:Lrriq1 UTSW 10 103,057,150 (GRCm39) missense possibly damaging 0.91
R0515:Lrriq1 UTSW 10 102,904,829 (GRCm39) splice site probably null
R0522:Lrriq1 UTSW 10 102,997,638 (GRCm39) missense probably damaging 0.99
R0701:Lrriq1 UTSW 10 103,069,905 (GRCm39) missense probably benign
R1220:Lrriq1 UTSW 10 102,906,990 (GRCm39) missense probably benign 0.05
R1261:Lrriq1 UTSW 10 103,069,998 (GRCm39) missense possibly damaging 0.87
R1262:Lrriq1 UTSW 10 103,069,998 (GRCm39) missense possibly damaging 0.87
R1451:Lrriq1 UTSW 10 103,038,376 (GRCm39) splice site probably benign
R1642:Lrriq1 UTSW 10 103,050,317 (GRCm39) missense probably benign 0.13
R1643:Lrriq1 UTSW 10 103,050,685 (GRCm39) missense probably benign 0.00
R1647:Lrriq1 UTSW 10 103,006,509 (GRCm39) nonsense probably null
R1830:Lrriq1 UTSW 10 102,997,620 (GRCm39) missense probably benign
R1843:Lrriq1 UTSW 10 103,063,034 (GRCm39) splice site probably null
R2129:Lrriq1 UTSW 10 103,050,718 (GRCm39) missense probably benign 0.01
R2199:Lrriq1 UTSW 10 102,904,774 (GRCm39) missense probably damaging 1.00
R2354:Lrriq1 UTSW 10 103,025,848 (GRCm39) missense probably damaging 1.00
R2495:Lrriq1 UTSW 10 103,038,242 (GRCm39) missense probably damaging 0.97
R2897:Lrriq1 UTSW 10 103,063,111 (GRCm39) missense probably damaging 0.99
R2898:Lrriq1 UTSW 10 103,063,111 (GRCm39) missense probably damaging 0.99
R2922:Lrriq1 UTSW 10 103,050,536 (GRCm39) missense probably benign 0.00
R2939:Lrriq1 UTSW 10 102,980,750 (GRCm39) missense probably damaging 0.98
R2965:Lrriq1 UTSW 10 103,050,761 (GRCm39) missense probably benign 0.07
R2966:Lrriq1 UTSW 10 103,050,761 (GRCm39) missense probably benign 0.07
R3081:Lrriq1 UTSW 10 102,980,750 (GRCm39) missense probably damaging 0.98
R3115:Lrriq1 UTSW 10 103,006,294 (GRCm39) missense probably benign 0.00
R3745:Lrriq1 UTSW 10 103,006,717 (GRCm39) missense probably damaging 0.99
R3813:Lrriq1 UTSW 10 103,051,972 (GRCm39) missense probably damaging 1.00
R3814:Lrriq1 UTSW 10 103,051,972 (GRCm39) missense probably damaging 1.00
R3885:Lrriq1 UTSW 10 103,051,967 (GRCm39) missense probably damaging 0.96
R4378:Lrriq1 UTSW 10 103,038,225 (GRCm39) missense probably damaging 1.00
R4632:Lrriq1 UTSW 10 103,057,288 (GRCm39) missense probably damaging 1.00
R4633:Lrriq1 UTSW 10 103,036,424 (GRCm39) nonsense probably null
R4663:Lrriq1 UTSW 10 102,899,273 (GRCm39) missense possibly damaging 0.88
R4702:Lrriq1 UTSW 10 103,051,610 (GRCm39) missense possibly damaging 0.65
R4793:Lrriq1 UTSW 10 103,006,327 (GRCm39) missense probably benign 0.25
R4801:Lrriq1 UTSW 10 103,057,179 (GRCm39) missense probably benign 0.02
R4802:Lrriq1 UTSW 10 103,057,179 (GRCm39) missense probably benign 0.02
R4815:Lrriq1 UTSW 10 102,980,739 (GRCm39) missense probably benign 0.10
R4872:Lrriq1 UTSW 10 103,014,649 (GRCm39) missense possibly damaging 0.56
R4877:Lrriq1 UTSW 10 103,069,899 (GRCm39) missense possibly damaging 0.88
R4894:Lrriq1 UTSW 10 102,997,613 (GRCm39) missense possibly damaging 0.86
R4990:Lrriq1 UTSW 10 103,036,420 (GRCm39) missense probably damaging 1.00
R4991:Lrriq1 UTSW 10 103,036,420 (GRCm39) missense probably damaging 1.00
R5011:Lrriq1 UTSW 10 103,025,784 (GRCm39) missense probably damaging 1.00
R5013:Lrriq1 UTSW 10 103,025,784 (GRCm39) missense probably damaging 1.00
R5122:Lrriq1 UTSW 10 103,023,314 (GRCm39) missense probably damaging 1.00
R5282:Lrriq1 UTSW 10 103,051,206 (GRCm39) missense probably benign 0.01
R5311:Lrriq1 UTSW 10 103,050,448 (GRCm39) missense probably damaging 1.00
R5567:Lrriq1 UTSW 10 103,006,457 (GRCm39) missense possibly damaging 0.56
R5643:Lrriq1 UTSW 10 103,051,301 (GRCm39) missense probably benign 0.00
R5683:Lrriq1 UTSW 10 103,009,236 (GRCm39) missense probably damaging 1.00
R5916:Lrriq1 UTSW 10 103,057,243 (GRCm39) nonsense probably null
R6008:Lrriq1 UTSW 10 103,006,325 (GRCm39) missense probably damaging 1.00
R6022:Lrriq1 UTSW 10 103,051,395 (GRCm39) missense possibly damaging 0.90
R6224:Lrriq1 UTSW 10 103,051,618 (GRCm39) missense probably damaging 1.00
R6254:Lrriq1 UTSW 10 103,051,312 (GRCm39) missense probably benign 0.15
R6311:Lrriq1 UTSW 10 103,009,254 (GRCm39) missense probably benign 0.03
R6460:Lrriq1 UTSW 10 103,036,559 (GRCm39) missense probably damaging 1.00
R6502:Lrriq1 UTSW 10 103,063,045 (GRCm39) missense probably damaging 0.99
R6637:Lrriq1 UTSW 10 103,057,293 (GRCm39) missense probably benign 0.06
R6719:Lrriq1 UTSW 10 102,906,977 (GRCm39) missense probably damaging 1.00
R6736:Lrriq1 UTSW 10 103,017,750 (GRCm39) critical splice acceptor site probably null
R6928:Lrriq1 UTSW 10 103,050,800 (GRCm39) missense possibly damaging 0.95
R6991:Lrriq1 UTSW 10 103,023,319 (GRCm39) missense probably damaging 1.00
R7174:Lrriq1 UTSW 10 103,060,826 (GRCm39) missense probably benign
R7241:Lrriq1 UTSW 10 103,051,834 (GRCm39) missense probably damaging 1.00
R7248:Lrriq1 UTSW 10 103,059,611 (GRCm39) missense possibly damaging 0.85
R7287:Lrriq1 UTSW 10 103,051,877 (GRCm39) missense probably benign 0.00
R7402:Lrriq1 UTSW 10 103,057,185 (GRCm39) missense possibly damaging 0.87
R7439:Lrriq1 UTSW 10 103,050,380 (GRCm39) missense probably benign 0.21
R7585:Lrriq1 UTSW 10 103,050,807 (GRCm39) missense possibly damaging 0.93
R7611:Lrriq1 UTSW 10 103,036,432 (GRCm39) missense possibly damaging 0.54
R7634:Lrriq1 UTSW 10 103,036,462 (GRCm39) missense probably damaging 1.00
R7767:Lrriq1 UTSW 10 103,051,815 (GRCm39) missense probably damaging 0.99
R7809:Lrriq1 UTSW 10 103,051,678 (GRCm39) missense probably damaging 0.99
R7910:Lrriq1 UTSW 10 103,051,055 (GRCm39) nonsense probably null
R8131:Lrriq1 UTSW 10 103,051,572 (GRCm39) missense possibly damaging 0.57
R8156:Lrriq1 UTSW 10 102,992,196 (GRCm39) critical splice donor site probably null
R8211:Lrriq1 UTSW 10 103,006,408 (GRCm39) missense probably damaging 1.00
R8304:Lrriq1 UTSW 10 103,069,929 (GRCm39) missense possibly damaging 0.57
R8487:Lrriq1 UTSW 10 103,050,914 (GRCm39) missense probably damaging 0.98
R8500:Lrriq1 UTSW 10 102,882,016 (GRCm39) missense
R9013:Lrriq1 UTSW 10 103,050,931 (GRCm39) missense probably damaging 1.00
R9099:Lrriq1 UTSW 10 103,051,864 (GRCm39) missense probably damaging 0.98
R9155:Lrriq1 UTSW 10 103,050,640 (GRCm39) missense probably benign 0.03
R9320:Lrriq1 UTSW 10 103,057,144 (GRCm39) missense probably benign
R9384:Lrriq1 UTSW 10 103,006,458 (GRCm39) missense probably benign 0.00
R9469:Lrriq1 UTSW 10 103,050,761 (GRCm39) missense probably benign 0.07
R9585:Lrriq1 UTSW 10 103,051,250 (GRCm39) missense probably benign
R9706:Lrriq1 UTSW 10 102,881,902 (GRCm39) missense
R9780:Lrriq1 UTSW 10 103,025,824 (GRCm39) missense probably damaging 1.00
X0026:Lrriq1 UTSW 10 103,051,565 (GRCm39) nonsense probably null
Z1088:Lrriq1 UTSW 10 103,038,307 (GRCm39) missense probably damaging 1.00
Z1176:Lrriq1 UTSW 10 103,069,946 (GRCm39) missense probably damaging 0.99
Z1176:Lrriq1 UTSW 10 103,038,221 (GRCm39) missense probably damaging 1.00
Z1176:Lrriq1 UTSW 10 103,038,220 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCAAAGATTTCAGCCCAGG -3'
(R):5'- TTTCCATGCAGAAAAGCCTACC -3'

Sequencing Primer
(F):5'- GATTTCAGCCCAGGGTTTAAATG -3'
(R):5'- TGCAGAAAAGCCTACCATCACTG -3'
Posted On 2014-09-17