Incidental Mutation 'R0152:Zfp68'
ID22775
Institutional Source Beutler Lab
Gene Symbol Zfp68
Ensembl Gene ENSMUSG00000058291
Gene Namezinc finger protein 68
SynonymsZfp68, Zfp70, KRAZ2, KRAB3
MMRRC Submission 038435-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.753) question?
Stock #R0152 (G1)
Quality Score225
Status Validated (trace)
Chromosome5
Chromosomal Location138603652-138619761 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 138606613 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 445 (K445E)
Ref Sequence ENSEMBL: ENSMUSP00000083013 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063262] [ENSMUST00000085852] [ENSMUST00000110905]
Predicted Effect probably damaging
Transcript: ENSMUST00000063262
AA Change: K483E

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000069615
Gene: ENSMUSG00000058291
AA Change: K483E

DomainStartEndE-ValueType
KRAB 10 70 1.11e-30 SMART
ZnF_C2H2 317 339 1.58e-3 SMART
ZnF_C2H2 345 367 3.16e-3 SMART
ZnF_C2H2 373 395 5.5e-3 SMART
ZnF_C2H2 401 423 2.27e-4 SMART
ZnF_C2H2 429 451 3.44e-4 SMART
ZnF_C2H2 457 479 3.07e-1 SMART
ZnF_C2H2 485 507 2.09e-3 SMART
ZnF_C2H2 513 535 3.29e-1 SMART
ZnF_C2H2 541 563 2.99e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000085852
AA Change: K445E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000083013
Gene: ENSMUSG00000058291
AA Change: K445E

DomainStartEndE-ValueType
KRAB 1 32 6e-1 SMART
ZnF_C2H2 279 301 1.58e-3 SMART
ZnF_C2H2 307 329 3.16e-3 SMART
ZnF_C2H2 335 357 5.5e-3 SMART
ZnF_C2H2 363 385 2.27e-4 SMART
ZnF_C2H2 391 413 3.44e-4 SMART
ZnF_C2H2 419 441 3.07e-1 SMART
ZnF_C2H2 447 469 2.09e-3 SMART
ZnF_C2H2 475 497 3.29e-1 SMART
ZnF_C2H2 503 525 2.99e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110905
AA Change: K483E

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106530
Gene: ENSMUSG00000058291
AA Change: K483E

DomainStartEndE-ValueType
KRAB 10 70 1.11e-30 SMART
ZnF_C2H2 317 339 1.58e-3 SMART
ZnF_C2H2 345 367 3.16e-3 SMART
ZnF_C2H2 373 395 5.5e-3 SMART
ZnF_C2H2 401 423 2.27e-4 SMART
ZnF_C2H2 429 451 3.44e-4 SMART
ZnF_C2H2 457 479 3.07e-1 SMART
ZnF_C2H2 485 507 2.09e-3 SMART
ZnF_C2H2 513 535 3.29e-1 SMART
ZnF_C2H2 541 563 2.99e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119137
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175175
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197654
Meta Mutation Damage Score 0.2148 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.3%
  • 20x: 89.5%
Validation Efficiency 87% (40/46)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass T C 6: 23,074,689 D834G probably damaging Het
Abca13 T A 11: 9,581,724 H4650Q probably damaging Het
Aqr T A 2: 114,159,010 T111S probably benign Het
Arfip2 G A 7: 105,637,223 T124M probably damaging Het
Arhgap44 G T 11: 65,011,919 A574E probably benign Het
Arhgef26 T C 3: 62,423,544 S560P probably damaging Het
Car5a T A 8: 121,916,446 N273I probably damaging Het
Cd4 G A 6: 124,867,746 Q359* probably null Het
Cgrrf1 G A 14: 46,853,913 C298Y probably damaging Het
Clip3 G A 7: 30,303,432 A416T probably benign Het
Dst C T 1: 34,189,119 P1606L probably damaging Het
Eif3e G A 15: 43,252,236 A378V possibly damaging Het
Ercc6 C G 14: 32,546,905 probably benign Het
Eri2 A G 7: 119,790,383 V104A probably damaging Het
Exph5 T A 9: 53,353,204 probably null Het
Hmcn1 A T 1: 150,663,879 Y2954N probably benign Het
Itga2 C T 13: 114,866,314 G547R probably benign Het
Kbtbd11 T C 8: 15,027,428 V9A probably damaging Het
Ldb2 T C 5: 44,541,799 D99G possibly damaging Het
Mfsd12 G T 10: 81,357,799 D68Y probably damaging Het
Mgarp T C 3: 51,388,963 D228G probably benign Het
Myh14 A T 7: 44,623,181 L1441Q probably damaging Het
Obscn T C 11: 59,052,576 D4810G probably benign Het
Olfr1331 T A 4: 118,868,886 I34N possibly damaging Het
Olfr1448 A G 19: 12,920,108 V67A possibly damaging Het
Olfr293 A T 7: 86,664,511 Y283F probably damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr948 A G 9: 39,319,461 I51T probably benign Het
Pdhx A G 2: 103,028,280 V393A probably benign Het
Pdpk1 C T 17: 24,106,946 R92H possibly damaging Het
Pgr A T 9: 8,965,022 I889F probably benign Het
Pum2 T A 12: 8,728,754 I468K possibly damaging Het
Recql5 A G 11: 115,894,673 S666P probably benign Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc26a4 T C 12: 31,529,498 I588M probably damaging Het
Slc9a2 A G 1: 40,742,804 T398A probably damaging Het
Snapc1 C T 12: 73,975,032 R81C probably damaging Het
Tub A T 7: 109,020,927 N93Y probably damaging Het
Usp3 T C 9: 66,540,150 T181A probably damaging Het
Vars2 A G 17: 35,660,027 L637P probably damaging Het
Vmn2r1 T C 3: 64,081,819 S60P possibly damaging Het
Wdcp A G 12: 4,851,583 S480G probably benign Het
Zbtb38 T C 9: 96,686,280 Y917C probably damaging Het
Zmynd10 A G 9: 107,550,945 probably null Het
Other mutations in Zfp68
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02167:Zfp68 APN 5 138606367 missense probably benign 0.00
R0040:Zfp68 UTSW 5 138607779 missense probably benign 0.24
R0040:Zfp68 UTSW 5 138607779 missense probably benign 0.24
R0390:Zfp68 UTSW 5 138607225 missense probably benign 0.14
R1490:Zfp68 UTSW 5 138606829 missense probably benign 0.16
R4688:Zfp68 UTSW 5 138616481 nonsense probably null
R4992:Zfp68 UTSW 5 138607337 missense possibly damaging 0.50
R5072:Zfp68 UTSW 5 138606317 missense probably benign 0.01
R7076:Zfp68 UTSW 5 138606939 missense possibly damaging 0.49
R7117:Zfp68 UTSW 5 138606318 missense probably benign 0.01
R7332:Zfp68 UTSW 5 138606568 missense possibly damaging 0.90
R8399:Zfp68 UTSW 5 138607820 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CAGGGTCCCCTTAGCTGTAAGAAGAAT -3'
(R):5'- GCATGAGAAGCTCTTTATCCAGAAGGAA -3'

Sequencing Primer
(F):5'- cttcatactatgaatcttctgatgcc -3'
(R):5'- atgaatgtaaggaatgtgggaaag -3'
Posted On2013-04-16