Incidental Mutation 'R0152:Cd4'
ID 22777
Institutional Source Beutler Lab
Gene Symbol Cd4
Ensembl Gene ENSMUSG00000023274
Gene Name CD4 antigen
Synonyms L3T4, Ly-4
MMRRC Submission 038435-MU
Accession Numbers

Genbank: NM_013488; MGI: 88335
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0152 (G1)
Quality Score 225
Status Validated (trace)
Chromosome 6
Chromosomal Location 124864692-124888221 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 124867746 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 359 (Q359*)
Ref Sequence ENSEMBL: ENSMUSP00000024044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024044] [ENSMUST00000046893] [ENSMUST00000204667]
AlphaFold P06332
Predicted Effect probably null
Transcript: ENSMUST00000024044
AA Change: Q359*
SMART Domains Protein: ENSMUSP00000024044
Gene: ENSMUSG00000023274
AA Change: Q359*

DomainStartEndE-ValueType
low complexity region 6 21 N/A INTRINSIC
IGv 37 114 7.02e-8 SMART
IG 131 206 3.63e-1 SMART
IG 212 317 3.36e0 SMART
transmembrane domain 394 416 N/A INTRINSIC
Pfam:Tcell_CD4_C 425 452 2.2e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000046893
SMART Domains Protein: ENSMUSP00000038536
Gene: ENSMUSG00000038390

DomainStartEndE-ValueType
Pfam:7tm_1 30 337 1.1e-19 PFAM
low complexity region 348 362 N/A INTRINSIC
low complexity region 462 477 N/A INTRINSIC
low complexity region 482 504 N/A INTRINSIC
low complexity region 513 540 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145818
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145977
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151594
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204161
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204253
Predicted Effect probably benign
Transcript: ENSMUST00000204667
SMART Domains Protein: ENSMUSP00000145267
Gene: ENSMUSG00000038390

DomainStartEndE-ValueType
Pfam:7tm_1 30 337 1.1e-19 PFAM
low complexity region 348 362 N/A INTRINSIC
low complexity region 462 477 N/A INTRINSIC
low complexity region 482 504 N/A INTRINSIC
low complexity region 513 540 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.3%
  • 20x: 89.5%
Validation Efficiency 87% (40/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane glycoprotein of T lymphocytes that interacts with major histocompatibility complex class II antigenes and is also a receptor for the human immunodeficiency virus. This gene is expressed not only in T lymphocytes, but also in B cells, macrophages, and granulocytes. It is also expressed in specific regions of the brain. The protein functions to initiate or augment the early phase of T-cell activation, and may function as an important mediator of indirect neuronal damage in infectious and immune-mediated diseases of the central nervous system. Multiple alternatively spliced transcript variants encoding different isoforms have been identified in this gene. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for knock-out alleles exhibit abnormal immune system morphology and physiology. [provided by MGI curators]
Allele List at MGI

 All alleles(25) : Targeted(13) Gene trapped(6) Spontaneous(2) Chemically induced(4)          
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass T C 6: 23,074,689 D834G probably damaging Het
Abca13 T A 11: 9,581,724 H4650Q probably damaging Het
Aqr T A 2: 114,159,010 T111S probably benign Het
Arfip2 G A 7: 105,637,223 T124M probably damaging Het
Arhgap44 G T 11: 65,011,919 A574E probably benign Het
Arhgef26 T C 3: 62,423,544 S560P probably damaging Het
Car5a T A 8: 121,916,446 N273I probably damaging Het
Cgrrf1 G A 14: 46,853,913 C298Y probably damaging Het
Clip3 G A 7: 30,303,432 A416T probably benign Het
Dst C T 1: 34,189,119 P1606L probably damaging Het
Eif3e G A 15: 43,252,236 A378V possibly damaging Het
Ercc6 C G 14: 32,546,905 probably benign Het
Eri2 A G 7: 119,790,383 V104A probably damaging Het
Exph5 T A 9: 53,353,204 probably null Het
Hmcn1 A T 1: 150,663,879 Y2954N probably benign Het
Itga2 C T 13: 114,866,314 G547R probably benign Het
Kbtbd11 T C 8: 15,027,428 V9A probably damaging Het
Ldb2 T C 5: 44,541,799 D99G possibly damaging Het
Mfsd12 G T 10: 81,357,799 D68Y probably damaging Het
Mgarp T C 3: 51,388,963 D228G probably benign Het
Myh14 A T 7: 44,623,181 L1441Q probably damaging Het
Obscn T C 11: 59,052,576 D4810G probably benign Het
Olfr1331 T A 4: 118,868,886 I34N possibly damaging Het
Olfr1448 A G 19: 12,920,108 V67A possibly damaging Het
Olfr293 A T 7: 86,664,511 Y283F probably damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr948 A G 9: 39,319,461 I51T probably benign Het
Pdhx A G 2: 103,028,280 V393A probably benign Het
Pdpk1 C T 17: 24,106,946 R92H possibly damaging Het
Pgr A T 9: 8,965,022 I889F probably benign Het
Pum2 T A 12: 8,728,754 I468K possibly damaging Het
Recql5 A G 11: 115,894,673 S666P probably benign Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc26a4 T C 12: 31,529,498 I588M probably damaging Het
Slc9a2 A G 1: 40,742,804 T398A probably damaging Het
Snapc1 C T 12: 73,975,032 R81C probably damaging Het
Tub A T 7: 109,020,927 N93Y probably damaging Het
Usp3 T C 9: 66,540,150 T181A probably damaging Het
Vars2 A G 17: 35,660,027 L637P probably damaging Het
Vmn2r1 T C 3: 64,081,819 S60P possibly damaging Het
Wdcp A G 12: 4,851,583 S480G probably benign Het
Zbtb38 T C 9: 96,686,280 Y917C probably damaging Het
Zfp68 T C 5: 138,606,613 K445E probably damaging Het
Zmynd10 A G 9: 107,550,945 probably null Het
Other mutations in Cd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
maat APN 6 124866684 unclassified probably benign
seshat APN 6 124872977 missense possibly damaging 0.81
thoth APN 6 124873140 splice site probably benign
IGL00783:Cd4 APN 6 124872989 missense possibly damaging 0.81
IGL00784:Cd4 APN 6 124872989 missense possibly damaging 0.81
IGL01294:Cd4 APN 6 124879378 missense probably benign 0.41
IGL01295:Cd4 APN 6 124879378 missense probably benign 0.41
IGL01296:Cd4 APN 6 124879378 missense probably benign 0.41
IGL01298:Cd4 APN 6 124879378 missense probably benign 0.41
IGL01299:Cd4 APN 6 124879378 missense probably benign 0.41
IGL01397:Cd4 APN 6 124879378 missense probably benign 0.41
IGL01401:Cd4 APN 6 124879378 missense probably benign 0.41
IGL01402:Cd4 APN 6 124879378 missense probably benign 0.41
IGL01407:Cd4 APN 6 124879378 missense probably benign 0.41
craw UTSW 6 124867746 nonsense probably null
Doubles UTSW 6 124872458 missense probably benign 0.01
fourless UTSW 6 124870244 critical splice donor site probably null
R0196:Cd4 UTSW 6 124867806 missense probably damaging 0.97
R1769:Cd4 UTSW 6 124866655 missense possibly damaging 0.71
R1992:Cd4 UTSW 6 124867688 missense possibly damaging 0.59
R2126:Cd4 UTSW 6 124870536 missense probably benign 0.01
R3237:Cd4 UTSW 6 124867670 missense probably benign 0.37
R3706:Cd4 UTSW 6 124879388 missense probably benign
R4535:Cd4 UTSW 6 124870451 missense probably benign 0.01
R5026:Cd4 UTSW 6 124866620 missense possibly damaging 0.95
R5084:Cd4 UTSW 6 124870439 missense probably damaging 1.00
R6628:Cd4 UTSW 6 124879468 missense unknown
R6772:Cd4 UTSW 6 124872458 missense probably benign 0.01
R7038:Cd4 UTSW 6 124870254 missense probably damaging 0.98
R7083:Cd4 UTSW 6 124870572 missense probably benign 0.16
R7313:Cd4 UTSW 6 124867103 missense probably benign 0.15
R7394:Cd4 UTSW 6 124873041 missense probably benign 0.00
R7943:Cd4 UTSW 6 124870244 critical splice donor site probably null
R9187:Cd4 UTSW 6 124867688 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGCTCTTAGCCAGGAAGACCTCAC -3'
(R):5'- TCCACGCTTACAGCTTGAACCC -3'

Sequencing Primer
(F):5'- CTCACTCCTAAGCTGTGTGGAAG -3'
(R):5'- TTGAACCCCGAGCAGCAG -3'
Posted On 2013-04-16