Incidental Mutation 'R0152:Clip3'
ID22779
Institutional Source Beutler Lab
Gene Symbol Clip3
Ensembl Gene ENSMUSG00000013921
Gene NameCAP-GLY domain containing linker protein 3
Synonyms
MMRRC Submission 038435-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.834) question?
Stock #R0152 (G1)
Quality Score225
Status Validated (trace)
Chromosome7
Chromosomal Location30291728-30308367 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 30303432 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 416 (A416T)
Ref Sequence ENSEMBL: ENSMUSP00000014065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014065]
PDB Structure
Solution structure of the 2nd CAP-Gly domain in mouse CLIP170-related 59kDa protein CLIPR-59 [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000014065
AA Change: A416T

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000014065
Gene: ENSMUSG00000013921
AA Change: A416T

DomainStartEndE-ValueType
low complexity region 6 33 N/A INTRINSIC
ANK 117 155 1.04e2 SMART
ANK 160 191 3.74e0 SMART
ANK 197 226 3.54e-1 SMART
CAP_GLY 296 361 2.16e-33 SMART
low complexity region 367 379 N/A INTRINSIC
low complexity region 387 408 N/A INTRINSIC
CAP_GLY 418 483 1.4e-32 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125935
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132844
Meta Mutation Damage Score 0.0591 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.3%
  • 20x: 89.5%
Validation Efficiency 87% (40/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytoplasmic linker protein 170 family. Members of this protein family contain a cytoskeleton-associated protein glycine-rich domain and mediate the interaction of microtubules with cellular organelles. The encoded protein plays a role in T cell apoptosis by facilitating the association of tubulin and the lipid raft ganglioside GD3. The encoded protein also functions as a scaffold protein mediating membrane localization of phosphorylated protein kinase B. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired phrenic nerve-elicited muscle contraction, defects in diaphragm innervation, altered neuromuscular junction stability, abnormal motor innervation of other muscles, and complete neonatal lethality due to respiratory failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass T C 6: 23,074,689 D834G probably damaging Het
Abca13 T A 11: 9,581,724 H4650Q probably damaging Het
Aqr T A 2: 114,159,010 T111S probably benign Het
Arfip2 G A 7: 105,637,223 T124M probably damaging Het
Arhgap44 G T 11: 65,011,919 A574E probably benign Het
Arhgef26 T C 3: 62,423,544 S560P probably damaging Het
Car5a T A 8: 121,916,446 N273I probably damaging Het
Cd4 G A 6: 124,867,746 Q359* probably null Het
Cgrrf1 G A 14: 46,853,913 C298Y probably damaging Het
Dst C T 1: 34,189,119 P1606L probably damaging Het
Eif3e G A 15: 43,252,236 A378V possibly damaging Het
Ercc6 C G 14: 32,546,905 probably benign Het
Eri2 A G 7: 119,790,383 V104A probably damaging Het
Exph5 T A 9: 53,353,204 probably null Het
Hmcn1 A T 1: 150,663,879 Y2954N probably benign Het
Itga2 C T 13: 114,866,314 G547R probably benign Het
Kbtbd11 T C 8: 15,027,428 V9A probably damaging Het
Ldb2 T C 5: 44,541,799 D99G possibly damaging Het
Mfsd12 G T 10: 81,357,799 D68Y probably damaging Het
Mgarp T C 3: 51,388,963 D228G probably benign Het
Myh14 A T 7: 44,623,181 L1441Q probably damaging Het
Obscn T C 11: 59,052,576 D4810G probably benign Het
Olfr1331 T A 4: 118,868,886 I34N possibly damaging Het
Olfr1448 A G 19: 12,920,108 V67A possibly damaging Het
Olfr293 A T 7: 86,664,511 Y283F probably damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr948 A G 9: 39,319,461 I51T probably benign Het
Pdhx A G 2: 103,028,280 V393A probably benign Het
Pdpk1 C T 17: 24,106,946 R92H possibly damaging Het
Pgr A T 9: 8,965,022 I889F probably benign Het
Pum2 T A 12: 8,728,754 I468K possibly damaging Het
Recql5 A G 11: 115,894,673 S666P probably benign Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc26a4 T C 12: 31,529,498 I588M probably damaging Het
Slc9a2 A G 1: 40,742,804 T398A probably damaging Het
Snapc1 C T 12: 73,975,032 R81C probably damaging Het
Tub A T 7: 109,020,927 N93Y probably damaging Het
Usp3 T C 9: 66,540,150 T181A probably damaging Het
Vars2 A G 17: 35,660,027 L637P probably damaging Het
Vmn2r1 T C 3: 64,081,819 S60P possibly damaging Het
Wdcp A G 12: 4,851,583 S480G probably benign Het
Zbtb38 T C 9: 96,686,280 Y917C probably damaging Het
Zfp68 T C 5: 138,606,613 K445E probably damaging Het
Zmynd10 A G 9: 107,550,945 probably null Het
Other mutations in Clip3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01642:Clip3 APN 7 30298862 missense probably benign 0.11
IGL01642:Clip3 APN 7 30297069 splice site probably benign
IGL03004:Clip3 APN 7 30292364 missense probably damaging 1.00
R1474:Clip3 UTSW 7 30298882 missense possibly damaging 0.57
R1778:Clip3 UTSW 7 30297436 missense probably damaging 1.00
R5024:Clip3 UTSW 7 30292219 unclassified probably benign
R5561:Clip3 UTSW 7 30298849 missense possibly damaging 0.93
R5908:Clip3 UTSW 7 30296873 missense probably damaging 0.99
R5912:Clip3 UTSW 7 30298870 missense probably benign 0.22
R5941:Clip3 UTSW 7 30292306 missense probably damaging 1.00
R7283:Clip3 UTSW 7 30305812 missense probably damaging 1.00
R7471:Clip3 UTSW 7 30301952 missense possibly damaging 0.89
R7516:Clip3 UTSW 7 30298843 missense possibly damaging 0.90
Z1176:Clip3 UTSW 7 30298838 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTTTTGCTGTCTGGTCACACTAGGG -3'
(R):5'- ACACAGAGCCGTCATGTTTGCC -3'

Sequencing Primer
(F):5'- CACACTAGGGATTGTATTCAGGACTC -3'
(R):5'- GTCCAGCTCGATGCCATAC -3'
Posted On2013-04-16