Incidental Mutation 'R2128:Fgd1'
ID227792
Institutional Source Beutler Lab
Gene Symbol Fgd1
Ensembl Gene ENSMUSG00000025265
Gene NameFYVE, RhoGEF and PH domain containing 1
Synonymsfaciogenital dysplasia, ZFYVE3
MMRRC Submission 040131-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R2128 (G1)
Quality Score222
Status Not validated
ChromosomeX
Chromosomal Location151046150-151089521 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 151086217 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000108305 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026295] [ENSMUST00000026296] [ENSMUST00000112683] [ENSMUST00000112685] [ENSMUST00000112685] [ENSMUST00000166010]
Predicted Effect probably benign
Transcript: ENSMUST00000026295
SMART Domains Protein: ENSMUSP00000026295
Gene: ENSMUSG00000025264

DomainStartEndE-ValueType
Pfam:WGG 12 93 7e-30 PFAM
low complexity region 133 152 N/A INTRINSIC
low complexity region 166 177 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000026296
SMART Domains Protein: ENSMUSP00000026296
Gene: ENSMUSG00000025265

DomainStartEndE-ValueType
low complexity region 137 150 N/A INTRINSIC
low complexity region 152 165 N/A INTRINSIC
low complexity region 171 193 N/A INTRINSIC
low complexity region 202 213 N/A INTRINSIC
low complexity region 230 257 N/A INTRINSIC
low complexity region 282 294 N/A INTRINSIC
low complexity region 340 353 N/A INTRINSIC
RhoGEF 376 559 5.24e-67 SMART
PH 590 690 1.88e-18 SMART
FYVE 721 790 4.2e-27 SMART
PH 821 922 2.56e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112683
SMART Domains Protein: ENSMUSP00000108303
Gene: ENSMUSG00000025264

DomainStartEndE-ValueType
Pfam:WGG 12 93 5.6e-30 PFAM
low complexity region 135 149 N/A INTRINSIC
low complexity region 163 174 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000112685
SMART Domains Protein: ENSMUSP00000108305
Gene: ENSMUSG00000025265

DomainStartEndE-ValueType
low complexity region 2 24 N/A INTRINSIC
low complexity region 33 44 N/A INTRINSIC
low complexity region 61 88 N/A INTRINSIC
low complexity region 113 125 N/A INTRINSIC
low complexity region 171 184 N/A INTRINSIC
RhoGEF 207 390 5.24e-67 SMART
PH 421 521 1.88e-18 SMART
FYVE 552 621 4.2e-27 SMART
PH 652 753 2.56e-11 SMART
Predicted Effect probably null
Transcript: ENSMUST00000112685
SMART Domains Protein: ENSMUSP00000108305
Gene: ENSMUSG00000025265

DomainStartEndE-ValueType
low complexity region 2 24 N/A INTRINSIC
low complexity region 33 44 N/A INTRINSIC
low complexity region 61 88 N/A INTRINSIC
low complexity region 113 125 N/A INTRINSIC
low complexity region 171 184 N/A INTRINSIC
RhoGEF 207 390 5.24e-67 SMART
PH 421 521 1.88e-18 SMART
FYVE 552 621 4.2e-27 SMART
PH 652 753 2.56e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125620
Predicted Effect probably benign
Transcript: ENSMUST00000166010
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166689
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of family of Rho-specific guanine nucleotide exchange factors. Rho-specific guanine nucleotide exchange factors catalyze the exchange of GDP for GTP and activate small GTPases, which function as molecular switches in signaling. This protein specifically binds cell division cycle 42, a Rho (Ras homology) GTPase. Investigations in mouse suggest that this protein is important for skeletal mineralization and for regulating the actin cytoskeleton. In humans, mutations in this gene are associated with faciogenital dysplasia, also known as Aarskog-Scott syndrome. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik A G 10: 87,230,204 E249G possibly damaging Het
2610028H24Rik A G 10: 76,457,515 M136V possibly damaging Het
4930523C07Rik A T 1: 160,075,375 K72* probably null Het
Abca6 A G 11: 110,219,649 I558T probably benign Het
Acot10 T C 15: 20,666,626 T10A probably benign Het
Adgrl4 T A 3: 151,500,201 D233E probably benign Het
Adgrv1 A T 13: 81,557,080 F1537Y probably damaging Het
Akap2 A G 4: 57,854,890 Y134C probably benign Het
Aqp3 T A 4: 41,098,061 I17F probably benign Het
Arap1 T A 7: 101,409,320 L1375H probably damaging Het
Aspm T C 1: 139,457,635 V339A probably benign Het
Atp13a3 G A 16: 30,354,276 A261V probably damaging Het
Casp8ap2 T C 4: 32,640,142 Y399H probably benign Het
Cept1 A G 3: 106,512,879 V213A probably damaging Het
Cit A G 5: 115,985,507 D1469G possibly damaging Het
Cnga2 A G X: 72,007,788 Y182C possibly damaging Het
Cox20 A G 1: 178,321,947 I54V probably benign Het
Dhx8 C A 11: 101,738,409 D261E probably benign Het
Dnah2 A T 11: 69,458,185 I2486N probably benign Het
Dnah5 A G 15: 28,408,321 Q3484R probably benign Het
Drd1 T C 13: 54,053,553 Y207C probably damaging Het
Dtl C T 1: 191,558,110 V222I probably damaging Het
Dync1h1 T C 12: 110,640,882 Y2636H probably damaging Het
Endog C A 2: 30,172,036 D154E probably benign Het
Epc1 A T 18: 6,462,954 V14E probably damaging Het
Ercc4 C A 16: 13,147,934 T810K probably damaging Het
Fam43b T A 4: 138,395,988 N7I possibly damaging Het
Filip1 G T 9: 79,819,330 T669N probably damaging Het
Fndc1 A G 17: 7,778,665 probably benign Het
Foxk1 C A 5: 142,435,188 S189* probably null Het
Gatm T C 2: 122,600,536 N274S probably damaging Het
Gdf9 A G 11: 53,437,507 Y430C probably damaging Het
Gga1 C T 15: 78,888,448 P260S probably damaging Het
Gm11595 A T 11: 99,772,501 C118S unknown Het
Gm382 G T X: 127,062,651 V820L possibly damaging Het
Gzmk T A 13: 113,172,014 I179F probably damaging Het
Hsp90b1 T C 10: 86,695,706 D421G probably damaging Het
Hus1 A G 11: 9,006,011 M174T probably damaging Het
Ifngr2 T A 16: 91,562,873 Y289* probably null Het
Il6st T A 13: 112,504,175 H828Q probably benign Het
Impg2 T A 16: 56,218,379 Y127N probably damaging Het
Irf3 T A 7: 45,001,744 W345R probably damaging Het
Kif1b G A 4: 149,187,640 S1568L possibly damaging Het
Klhl42 A G 6: 147,101,753 T342A probably benign Het
Kndc1 G T 7: 139,930,112 R1289L probably damaging Het
Knl1 A T 2: 119,071,819 T1334S possibly damaging Het
L3mbtl3 G T 10: 26,313,868 D499E unknown Het
Ldhd T A 8: 111,627,048 M478L probably benign Het
Loxl4 C G 19: 42,603,963 E385D probably damaging Het
Lrriq1 G A 10: 103,214,857 T678I probably benign Het
Macf1 T A 4: 123,492,774 I1017F probably benign Het
Madcam1 A G 10: 79,665,572 E157G possibly damaging Het
Mamdc4 T C 2: 25,569,258 D195G probably damaging Het
Mctp1 A G 13: 76,824,822 D648G probably damaging Het
Mycbp2 T C 14: 103,201,230 M2072V probably benign Het
Nck1 A G 9: 100,497,547 probably null Het
Ndufaf4 G T 4: 24,898,608 D55Y probably damaging Het
Nek11 A T 9: 105,300,361 D230E probably benign Het
Nit2 T C 16: 57,161,196 K67E possibly damaging Het
Olfr2 T C 7: 107,001,248 D204G probably damaging Het
Olfr290 T C 7: 84,916,493 F238S probably damaging Het
Olfr527 C T 7: 140,336,429 T189M probably damaging Het
Olfr802 A T 10: 129,682,532 V69E possibly damaging Het
Pccb G C 9: 100,985,831 D347E probably damaging Het
Plcl1 T A 1: 55,697,838 F779L probably damaging Het
Prune2 C A 19: 17,122,422 D1763E probably benign Het
Pwwp2a A G 11: 43,705,318 S437G probably benign Het
Rabgap1l A T 1: 160,738,957 D90E probably benign Het
Rapgef4 T A 2: 72,226,553 I552N possibly damaging Het
Scn7a A T 2: 66,697,986 I720K probably damaging Het
Scn9a T A 2: 66,526,654 N1101I probably damaging Het
Siglec1 A T 2: 131,080,497 Y553N probably damaging Het
Slc22a23 A G 13: 34,203,970 L381P possibly damaging Het
Slc7a11 T A 3: 50,384,109 T284S probably damaging Het
Slc8a2 T A 7: 16,140,492 probably null Het
Snx29 T A 16: 11,400,971 S224T probably damaging Het
Stox1 T C 10: 62,664,535 T749A probably benign Het
Tg A G 15: 66,694,894 I1264V probably benign Het
Tmem110 T C 14: 30,866,624 Y103H probably damaging Het
Top2a A C 11: 99,009,807 V609G probably damaging Het
Trmt44 G A 5: 35,574,832 P72S probably benign Het
Ttll3 G C 6: 113,412,934 S760T probably benign Het
Ttn G A 2: 76,833,897 probably benign Het
Ttn T C 2: 76,748,678 D23957G probably damaging Het
Ubxn1 T G 19: 8,872,070 V59G probably benign Het
Ubxn4 T C 1: 128,244,510 S14P probably benign Het
Uso1 T A 5: 92,195,370 M771K probably benign Het
Utp20 A G 10: 88,814,055 F431S probably damaging Het
Vmn1r206 T C 13: 22,620,612 S142G probably benign Het
Vmn2r19 A G 6: 123,308,330 probably null Het
Vps36 G T 8: 22,218,289 probably null Het
Wnt3 A G 11: 103,812,648 H319R possibly damaging Het
Zbtb26 G T 2: 37,436,551 Q158K probably benign Het
Zfp648 T C 1: 154,204,607 S171P probably benign Het
Other mutations in Fgd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00475:Fgd1 APN X 151072444 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CAGTCATGTGTAGCAGGGACAG -3'
(R):5'- CACTTTCTGGGGTGCAATCTG -3'

Sequencing Primer
(F):5'- CTGGGTCTAGAACTCCAGGCTAAG -3'
(R):5'- GTGCAATCTGTAGCCCTACTAGCAG -3'
Posted On2014-09-17