Incidental Mutation 'R2129:Clca3a1'
ID 227811
Institutional Source Beutler Lab
Gene Symbol Clca3a1
Ensembl Gene ENSMUSG00000056025
Gene Name chloride channel accessory 3A1
Synonyms Clca1
MMRRC Submission 040132-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.065) question?
Stock # R2129 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 144435438-144466738 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 144722526 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 282 (D282G)
Ref Sequence ENSEMBL: ENSMUSP00000029919 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029919]
AlphaFold Q9QX15
Predicted Effect probably damaging
Transcript: ENSMUST00000029919
AA Change: D282G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029919
Gene: ENSMUSG00000028255
AA Change: D282G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 285 297 N/A INTRINSIC
VWA 305 478 5.05e-19 SMART
Blast:FN3 753 852 2e-28 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198832
Meta Mutation Damage Score 0.5241 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 99% (91/92)
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik A G 10: 87,066,066 (GRCm39) E249G possibly damaging Het
2610028H24Rik A G 10: 76,293,349 (GRCm39) M136V possibly damaging Het
4930523C07Rik A T 1: 159,902,945 (GRCm39) K72* probably null Het
Abhd14a A T 9: 106,318,064 (GRCm39) L125Q probably null Het
Abhd17b T A 19: 21,658,413 (GRCm39) probably null Het
Abo G A 2: 26,736,586 (GRCm39) T61I probably benign Het
Adamts15 T C 9: 30,815,799 (GRCm39) T686A probably benign Het
Adgrv1 A T 13: 81,705,199 (GRCm39) F1537Y probably damaging Het
Anxa2 A T 9: 69,383,410 (GRCm39) Y75F possibly damaging Het
Aqp3 T A 4: 41,098,061 (GRCm39) I17F probably benign Het
Aspm T C 1: 139,385,373 (GRCm39) V339A probably benign Het
Bri3bp T A 5: 125,528,735 (GRCm39) L48* probably null Het
Car7 T A 8: 105,275,605 (GRCm39) C185S possibly damaging Het
Casp8ap2 T C 4: 32,640,142 (GRCm39) Y399H probably benign Het
Ces4a G A 8: 105,864,729 (GRCm39) G69S probably damaging Het
Chst10 A G 1: 38,904,776 (GRCm39) Y203H probably benign Het
Coq3 T G 4: 21,900,342 (GRCm39) S190A probably benign Het
Crocc G A 4: 140,744,407 (GRCm39) R1830C probably damaging Het
Cygb A G 11: 116,540,668 (GRCm39) L106P probably damaging Het
Dab2 G T 15: 6,365,864 (GRCm39) E87* probably null Het
Dcst1 T A 3: 89,264,852 (GRCm39) I299F probably damaging Het
Dennd4a T G 9: 64,813,256 (GRCm39) probably null Het
Depdc7 A G 2: 104,558,518 (GRCm39) S168P probably benign Het
Dicer1 G A 12: 104,688,290 (GRCm39) T429I probably damaging Het
Dnah5 A G 15: 28,408,467 (GRCm39) Q3484R probably benign Het
Dock2 T C 11: 34,618,242 (GRCm39) M125V probably damaging Het
Dync2h1 A G 9: 7,175,289 (GRCm39) S107P possibly damaging Het
Emb T C 13: 117,404,082 (GRCm39) V278A probably damaging Het
Firrm T C 1: 163,794,026 (GRCm39) Y518C probably damaging Het
Foxk1 C A 5: 142,420,943 (GRCm39) S189* probably null Het
Galm T C 17: 80,490,647 (GRCm39) I268T probably benign Het
Gm5581 A C 6: 131,145,247 (GRCm39) noncoding transcript Het
Gpr6 G A 10: 40,947,168 (GRCm39) S138L possibly damaging Het
Hesx1 C A 14: 26,722,802 (GRCm39) H42Q possibly damaging Het
Hsp90b1 T C 10: 86,531,570 (GRCm39) D421G probably damaging Het
Kctd19 T C 8: 106,111,804 (GRCm39) T31A probably damaging Het
Kif1b G A 4: 149,272,097 (GRCm39) S1568L possibly damaging Het
Krtap19-3 T C 16: 88,674,863 (GRCm39) probably benign Het
Lin28a T A 4: 133,745,465 (GRCm39) I43F probably benign Het
Lrriq1 G A 10: 103,050,718 (GRCm39) T678I probably benign Het
Macf1 A G 4: 123,262,608 (GRCm39) probably benign Het
Madcam1 A G 10: 79,501,406 (GRCm39) E157G possibly damaging Het
Mctp1 A G 13: 76,972,941 (GRCm39) D648G probably damaging Het
Megf8 T C 7: 25,030,140 (GRCm39) L425P probably damaging Het
Mospd4 A G 18: 46,598,731 (GRCm39) noncoding transcript Het
Mybpc1 T G 10: 88,387,314 (GRCm39) T466P probably damaging Het
Myo10 T C 15: 25,781,885 (GRCm39) Y1127H probably benign Het
Myo18b A T 5: 112,978,944 (GRCm39) L1223Q probably damaging Het
Myo9b T C 8: 71,786,343 (GRCm39) Y670H probably damaging Het
Ndufaf4 G T 4: 24,898,608 (GRCm39) D55Y probably damaging Het
Neurod2 G T 11: 98,218,414 (GRCm39) A250E possibly damaging Het
Nherf1 A T 11: 115,067,270 (GRCm39) I174F probably damaging Het
Nipsnap1 C A 11: 4,838,932 (GRCm39) N119K probably benign Het
Npffr2 A T 5: 89,715,924 (GRCm39) I84F probably damaging Het
Or10ab4 T A 7: 107,655,111 (GRCm39) N307K probably benign Het
Or11h23 A G 14: 50,948,093 (GRCm39) Y102C probably damaging Het
Or2t48 T C 11: 58,420,437 (GRCm39) D125G probably damaging Het
Pald1 A G 10: 61,184,085 (GRCm39) probably null Het
Palld T C 8: 62,330,395 (GRCm39) S161G probably benign Het
Paqr9 T A 9: 95,443,122 (GRCm39) F371I probably benign Het
Pear1 A T 3: 87,665,666 (GRCm39) C120* probably null Het
Pla2g4e A T 2: 120,013,292 (GRCm39) F343I probably damaging Het
Plxdc2 A T 2: 16,516,902 (GRCm39) Y61F probably benign Het
Polh G A 17: 46,499,014 (GRCm39) Q234* probably null Het
Prkce T A 17: 86,803,463 (GRCm39) M454K possibly damaging Het
Proser1 C A 3: 53,385,366 (GRCm39) T416K probably benign Het
Prr14l G T 5: 32,989,172 (GRCm39) probably benign Het
Rabgap1l A T 1: 160,566,527 (GRCm39) D90E probably benign Het
Rp1l1 T A 14: 64,266,415 (GRCm39) V667D possibly damaging Het
Rpp40 A T 13: 36,082,604 (GRCm39) C256* probably null Het
Rps6ka5 A G 12: 100,644,797 (GRCm39) L51P probably damaging Het
Rtp2 C T 16: 23,746,457 (GRCm39) C78Y probably damaging Het
Ryr3 A G 2: 112,508,715 (GRCm39) probably benign Het
Slc10a6 A G 5: 103,756,922 (GRCm39) Y281H probably benign Het
Slc6a21 T G 7: 44,932,197 (GRCm39) probably null Het
Smo A G 6: 29,757,313 (GRCm39) Y476C probably damaging Het
Tacr3 A T 3: 134,560,621 (GRCm39) T187S probably damaging Het
Tas1r3 G A 4: 155,944,927 (GRCm39) R765C probably damaging Het
Tasp1 T C 2: 139,890,164 (GRCm39) K71E possibly damaging Het
Tg A G 15: 66,566,743 (GRCm39) I1264V probably benign Het
Tmem41a T C 16: 21,764,911 (GRCm39) probably null Het
Tmem63a A G 1: 180,793,105 (GRCm39) N459D probably benign Het
Ube2k A G 5: 65,752,269 (GRCm39) T151A probably damaging Het
Ubr1 T C 2: 120,773,034 (GRCm39) E402G probably benign Het
Ulk4 T A 9: 120,981,248 (GRCm39) I897F probably benign Het
Usp30 A G 5: 114,249,224 (GRCm39) E176G probably damaging Het
Utp20 A G 10: 88,649,917 (GRCm39) F431S probably damaging Het
Vmn1r206 T C 13: 22,804,782 (GRCm39) S142G probably benign Het
Wdr17 C T 8: 55,085,416 (GRCm39) V1236M probably damaging Het
Zbtb32 T C 7: 30,290,918 (GRCm39) K126E possibly damaging Het
Zeb1 A T 18: 5,767,681 (GRCm39) S731C possibly damaging Het
Other mutations in Clca3a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00664:Clca3a1 APN 3 144,733,660 (GRCm39) missense probably benign 0.01
IGL00768:Clca3a1 APN 3 144,461,012 (GRCm39) missense probably damaging 0.96
IGL00862:Clca3a1 APN 3 144,730,332 (GRCm39) missense possibly damaging 0.89
IGL00895:Clca3a1 APN 3 144,730,357 (GRCm39) missense probably damaging 1.00
IGL00969:Clca3a1 APN 3 144,714,719 (GRCm39) missense possibly damaging 0.80
IGL01331:Clca3a1 APN 3 144,453,273 (GRCm39) missense probably damaging 1.00
IGL01398:Clca3a1 APN 3 144,722,512 (GRCm39) missense possibly damaging 0.81
IGL01447:Clca3a1 APN 3 144,713,539 (GRCm39) missense probably benign 0.00
IGL01455:Clca3a1 APN 3 144,713,539 (GRCm39) missense probably benign 0.00
IGL01457:Clca3a1 APN 3 144,713,539 (GRCm39) missense probably benign 0.00
IGL01458:Clca3a1 APN 3 144,713,539 (GRCm39) missense probably benign 0.00
IGL01462:Clca3a1 APN 3 144,713,539 (GRCm39) missense probably benign 0.00
IGL01473:Clca3a1 APN 3 144,713,539 (GRCm39) missense probably benign 0.00
IGL01488:Clca3a1 APN 3 144,713,539 (GRCm39) missense probably benign 0.00
IGL01490:Clca3a1 APN 3 144,713,539 (GRCm39) missense probably benign 0.00
IGL01632:Clca3a1 APN 3 144,733,202 (GRCm39) missense probably damaging 1.00
IGL01895:Clca3a1 APN 3 144,453,333 (GRCm39) nonsense probably null
IGL01896:Clca3a1 APN 3 144,721,438 (GRCm39) missense possibly damaging 0.79
IGL01940:Clca3a1 APN 3 144,452,737 (GRCm39) missense probably benign 0.25
IGL02162:Clca3a1 APN 3 144,460,564 (GRCm39) missense probably damaging 0.98
IGL02200:Clca3a1 APN 3 144,457,690 (GRCm39) splice site probably benign
IGL02411:Clca3a1 APN 3 144,733,763 (GRCm39) missense possibly damaging 0.89
IGL03093:Clca3a1 APN 3 144,453,262 (GRCm39) missense probably damaging 0.99
IGL03156:Clca3a1 APN 3 144,719,672 (GRCm39) missense probably damaging 1.00
Lucha UTSW 3 144,455,450 (GRCm39) missense probably damaging 1.00
R0256:Clca3a1 UTSW 3 144,436,640 (GRCm39) missense probably damaging 0.98
R0472:Clca3a1 UTSW 3 144,733,106 (GRCm39) missense probably damaging 1.00
R0513:Clca3a1 UTSW 3 144,466,323 (GRCm39) critical splice donor site probably null
R0543:Clca3a1 UTSW 3 144,454,155 (GRCm39) splice site probably benign
R0571:Clca3a1 UTSW 3 144,713,550 (GRCm39) missense probably damaging 1.00
R0585:Clca3a1 UTSW 3 144,738,386 (GRCm39) missense probably benign 0.16
R0586:Clca3a1 UTSW 3 144,738,350 (GRCm39) missense probably benign 0.45
R0791:Clca3a1 UTSW 3 144,710,615 (GRCm39) missense probably benign 0.01
R1187:Clca3a1 UTSW 3 144,715,504 (GRCm39) missense probably benign 0.30
R1522:Clca3a1 UTSW 3 144,460,932 (GRCm39) missense probably benign 0.01
R1713:Clca3a1 UTSW 3 144,730,307 (GRCm39) missense probably benign 0.00
R1739:Clca3a1 UTSW 3 144,713,539 (GRCm39) missense probably benign 0.00
R1744:Clca3a1 UTSW 3 144,452,596 (GRCm39) missense probably damaging 0.99
R1873:Clca3a1 UTSW 3 144,452,590 (GRCm39) missense probably damaging 0.99
R2079:Clca3a1 UTSW 3 144,713,534 (GRCm39) missense possibly damaging 0.80
R2178:Clca3a1 UTSW 3 144,711,863 (GRCm39) missense probably damaging 1.00
R2234:Clca3a1 UTSW 3 144,714,829 (GRCm39) missense possibly damaging 0.93
R2235:Clca3a1 UTSW 3 144,714,829 (GRCm39) missense possibly damaging 0.93
R2238:Clca3a1 UTSW 3 144,457,766 (GRCm39) missense possibly damaging 0.94
R2240:Clca3a1 UTSW 3 144,714,746 (GRCm39) missense probably damaging 1.00
R2278:Clca3a1 UTSW 3 144,463,785 (GRCm39) missense probably damaging 0.99
R2516:Clca3a1 UTSW 3 144,443,619 (GRCm39) splice site probably null
R3737:Clca3a1 UTSW 3 144,436,482 (GRCm39) missense probably benign 0.01
R3751:Clca3a1 UTSW 3 144,724,424 (GRCm39) missense probably benign 0.01
R3974:Clca3a1 UTSW 3 144,738,400 (GRCm39) missense probably damaging 1.00
R3975:Clca3a1 UTSW 3 144,738,400 (GRCm39) missense probably damaging 1.00
R3981:Clca3a1 UTSW 3 144,461,070 (GRCm39) missense probably benign 0.00
R3982:Clca3a1 UTSW 3 144,461,070 (GRCm39) missense probably benign 0.00
R3983:Clca3a1 UTSW 3 144,461,070 (GRCm39) missense probably benign 0.00
R4038:Clca3a1 UTSW 3 144,460,994 (GRCm39) missense probably benign 0.35
R4382:Clca3a1 UTSW 3 144,466,483 (GRCm39) start codon destroyed probably benign 0.08
R4409:Clca3a1 UTSW 3 144,711,788 (GRCm39) missense probably damaging 1.00
R4543:Clca3a1 UTSW 3 144,452,749 (GRCm39) missense probably damaging 1.00
R4586:Clca3a1 UTSW 3 144,722,619 (GRCm39) missense probably damaging 1.00
R4751:Clca3a1 UTSW 3 144,710,609 (GRCm39) missense possibly damaging 0.89
R4766:Clca3a1 UTSW 3 144,455,473 (GRCm39) missense probably damaging 1.00
R4894:Clca3a1 UTSW 3 144,719,662 (GRCm39) missense probably damaging 0.99
R4899:Clca3a1 UTSW 3 144,443,722 (GRCm39) missense probably damaging 1.00
R4909:Clca3a1 UTSW 3 144,730,324 (GRCm39) missense probably damaging 1.00
R4916:Clca3a1 UTSW 3 144,721,605 (GRCm39) missense probably benign 0.01
R4941:Clca3a1 UTSW 3 144,721,414 (GRCm39) missense probably damaging 1.00
R4942:Clca3a1 UTSW 3 144,710,524 (GRCm39) missense probably benign 0.02
R5044:Clca3a1 UTSW 3 144,713,689 (GRCm39) splice site probably null
R5090:Clca3a1 UTSW 3 144,443,633 (GRCm39) missense probably benign 0.01
R5091:Clca3a1 UTSW 3 144,436,483 (GRCm39) missense probably benign 0.00
R5205:Clca3a1 UTSW 3 144,452,545 (GRCm39) missense possibly damaging 0.68
R5248:Clca3a1 UTSW 3 144,442,897 (GRCm39) missense possibly damaging 0.62
R5354:Clca3a1 UTSW 3 144,442,766 (GRCm39) missense possibly damaging 0.77
R5451:Clca3a1 UTSW 3 144,733,747 (GRCm39) missense probably damaging 1.00
R5618:Clca3a1 UTSW 3 144,710,738 (GRCm39) missense probably benign 0.00
R5724:Clca3a1 UTSW 3 144,714,833 (GRCm39) missense probably benign 0.01
R5871:Clca3a1 UTSW 3 144,460,642 (GRCm39) missense probably damaging 1.00
R5898:Clca3a1 UTSW 3 144,722,522 (GRCm39) missense possibly damaging 0.89
R5907:Clca3a1 UTSW 3 144,455,403 (GRCm39) intron probably benign
R5976:Clca3a1 UTSW 3 144,452,636 (GRCm39) missense probably damaging 1.00
R6190:Clca3a1 UTSW 3 144,463,821 (GRCm39) missense probably benign 0.40
R6193:Clca3a1 UTSW 3 144,464,993 (GRCm39) missense possibly damaging 0.65
R6238:Clca3a1 UTSW 3 144,714,716 (GRCm39) missense probably benign 0.09
R6263:Clca3a1 UTSW 3 144,455,539 (GRCm39) missense probably damaging 1.00
R6299:Clca3a1 UTSW 3 144,464,275 (GRCm39) missense probably damaging 0.99
R6327:Clca3a1 UTSW 3 144,436,558 (GRCm39) missense probably benign 0.02
R6497:Clca3a1 UTSW 3 144,465,020 (GRCm39) missense possibly damaging 0.81
R6542:Clca3a1 UTSW 3 144,465,021 (GRCm39) missense probably benign 0.01
R6547:Clca3a1 UTSW 3 144,442,708 (GRCm39) missense probably damaging 1.00
R6590:Clca3a1 UTSW 3 144,719,644 (GRCm39) missense probably damaging 1.00
R6591:Clca3a1 UTSW 3 144,719,644 (GRCm39) missense probably damaging 1.00
R6592:Clca3a1 UTSW 3 144,719,644 (GRCm39) missense probably damaging 1.00
R6690:Clca3a1 UTSW 3 144,719,644 (GRCm39) missense probably damaging 1.00
R6691:Clca3a1 UTSW 3 144,719,644 (GRCm39) missense probably damaging 1.00
R6729:Clca3a1 UTSW 3 144,711,727 (GRCm39) missense probably damaging 1.00
R6759:Clca3a1 UTSW 3 144,455,450 (GRCm39) missense probably damaging 1.00
R6805:Clca3a1 UTSW 3 144,724,428 (GRCm39) missense probably damaging 1.00
R7032:Clca3a1 UTSW 3 144,453,329 (GRCm39) missense probably benign 0.07
R7063:Clca3a1 UTSW 3 144,460,967 (GRCm39) missense probably damaging 0.97
R7106:Clca3a1 UTSW 3 144,733,190 (GRCm39) missense probably damaging 0.98
R7121:Clca3a1 UTSW 3 144,717,567 (GRCm39) missense probably damaging 1.00
R7127:Clca3a1 UTSW 3 144,711,806 (GRCm39) missense probably damaging 1.00
R7139:Clca3a1 UTSW 3 144,461,063 (GRCm39) missense possibly damaging 0.58
R7212:Clca3a1 UTSW 3 144,711,727 (GRCm39) missense probably damaging 1.00
R7444:Clca3a1 UTSW 3 144,733,193 (GRCm39) missense probably damaging 1.00
R7446:Clca3a1 UTSW 3 144,733,188 (GRCm39) missense possibly damaging 0.65
R7535:Clca3a1 UTSW 3 144,724,328 (GRCm39) missense probably damaging 0.99
R7638:Clca3a1 UTSW 3 144,457,723 (GRCm39) missense probably damaging 1.00
R7663:Clca3a1 UTSW 3 144,442,797 (GRCm39) missense probably benign 0.02
R7792:Clca3a1 UTSW 3 144,455,492 (GRCm39) missense possibly damaging 0.95
R7798:Clca3a1 UTSW 3 144,463,723 (GRCm39) missense probably damaging 1.00
R7892:Clca3a1 UTSW 3 144,436,579 (GRCm39) missense probably benign 0.00
R8096:Clca3a1 UTSW 3 144,455,446 (GRCm39) missense probably damaging 1.00
R8305:Clca3a1 UTSW 3 144,464,927 (GRCm39) splice site probably benign
R8416:Clca3a1 UTSW 3 144,460,914 (GRCm39) critical splice donor site probably null
R8437:Clca3a1 UTSW 3 144,710,822 (GRCm39) missense probably benign 0.00
R8446:Clca3a1 UTSW 3 144,454,248 (GRCm39) missense probably damaging 0.97
R8474:Clca3a1 UTSW 3 144,710,792 (GRCm39) missense possibly damaging 0.77
R8496:Clca3a1 UTSW 3 144,453,182 (GRCm39) makesense probably null
R8766:Clca3a1 UTSW 3 144,714,939 (GRCm39) splice site probably benign
R8884:Clca3a1 UTSW 3 144,719,757 (GRCm39) missense probably benign 0.35
R9014:Clca3a1 UTSW 3 144,442,731 (GRCm39) missense probably benign 0.01
R9049:Clca3a1 UTSW 3 144,733,143 (GRCm39) missense probably benign 0.01
R9128:Clca3a1 UTSW 3 144,463,795 (GRCm39) missense probably damaging 1.00
R9306:Clca3a1 UTSW 3 144,730,339 (GRCm39) missense probably damaging 1.00
R9601:Clca3a1 UTSW 3 144,453,310 (GRCm39) missense probably benign 0.27
R9623:Clca3a1 UTSW 3 144,719,698 (GRCm39) missense probably benign 0.03
X0020:Clca3a1 UTSW 3 144,738,421 (GRCm39) missense possibly damaging 0.89
Z1088:Clca3a1 UTSW 3 144,452,714 (GRCm39) missense probably damaging 1.00
Z1176:Clca3a1 UTSW 3 144,719,682 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGTCCTGGTCCAGATTGTATCATTC -3'
(R):5'- TAAGCCAGCAGACAAGCCTG -3'

Sequencing Primer
(F):5'- GGTCCAGATTGTATCATTCACACATC -3'
(R):5'- CCTGGGAGTGCAGAGACTG -3'
Posted On 2014-09-17