Mutagenetix > Incidental Mutation

Incidental Mutation 'R2129:Clca1'

227811

Institutional Source

Beutler Lab

Gene Symbol

Clca1

Ensembl Gene

ENSMUSG00000028255

Gene Name

chloride channel accessory 1

Synonyms

gob-5, gob5, Clca3

MMRRC Submission

040132-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.105) question?

Stock #

R2129 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

145003817-145032776 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 145016765 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 282 (D282G)

Ref Sequence

ENSEMBL: ENSMUSP00000029919 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029919]

AlphaFold

Q9D7Z6

Predicted Effect

probably damaging
Transcript: ENSMUST00000029919
AA Change: D282G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000029919
Gene: ENSMUSG00000028255
AA Change: D282G

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
low complexity region	285	297	N/A	INTRINSIC
VWA	305	478	5.05e-19	SMART
Blast:FN3	753	852	2e-28	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000198832

Meta Mutation Damage Score

0.5241

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

99% (91/92)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the calcium sensitive chloride conductance protein family. To date, all members of this gene family map to the same region on chromosome 1p31-p22 and share a high degree of homology in size, sequence, and predicted structure, but differ significantly in their tissue distributions. The encoded protein is expressed as a precursor protein that is processed into two cell-surface-associated subunits, although the site at which the precursor is cleaved has not been precisely determined. The encoded protein may be involved in mediating calcium-activated chloride conductance in the intestine. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit an exacerbated mucin response. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 91 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700113H08Rik	A	G	10: 87,230,204	E249G	possibly damaging	Het
2610028H24Rik	A	G	10: 76,457,515	M136V	possibly damaging	Het
4930523C07Rik	A	T	1: 160,075,375	K72*	probably null	Het
Abhd14a	A	T	9: 106,440,865	L125Q	probably null	Het
Abhd17b	T	A	19: 21,681,049		probably null	Het
Abo	G	A	2: 26,846,574	T61I	probably benign	Het
Adamts15	T	C	9: 30,904,503	T686A	probably benign	Het
Adgrv1	A	T	13: 81,557,080	F1537Y	probably damaging	Het
Anxa2	A	T	9: 69,476,128	Y75F	possibly damaging	Het
Aqp3	T	A	4: 41,098,061	I17F	probably benign	Het
Aspm	T	C	1: 139,457,635	V339A	probably benign	Het
BC055324	T	C	1: 163,966,457	Y518C	probably damaging	Het
Bri3bp	T	A	5: 125,451,671	L48*	probably null	Het
Car7	T	A	8: 104,548,973	C185S	possibly damaging	Het
Casp8ap2	T	C	4: 32,640,142	Y399H	probably benign	Het
Ces4a	G	A	8: 105,138,097	G69S	probably damaging	Het
Chst10	A	G	1: 38,865,695	Y203H	probably benign	Het
Coq3	T	G	4: 21,900,342	S190A	probably benign	Het
Crocc	G	A	4: 141,017,096	R1830C	probably damaging	Het
Cygb	A	G	11: 116,649,842	L106P	probably damaging	Het
Dab2	G	T	15: 6,336,383	E87*	probably null	Het
Dcst1	T	A	3: 89,357,545	I299F	probably damaging	Het
Dennd4a	T	G	9: 64,905,974		probably null	Het
Depdc7	A	G	2: 104,728,173	S168P	probably benign	Het
Dicer1	G	A	12: 104,722,031	T429I	probably damaging	Het
Dnah5	A	G	15: 28,408,321	Q3484R	probably benign	Het
Dock2	T	C	11: 34,727,415	M125V	probably damaging	Het
Dync2h1	A	G	9: 7,175,289	S107P	possibly damaging	Het
Emb	T	C	13: 117,267,546	V278A	probably damaging	Het
Foxk1	C	A	5: 142,435,188	S189*	probably null	Het
Galm	T	C	17: 80,183,218	I268T	probably benign	Het
Gm5581	A	C	6: 131,168,284		noncoding transcript	Het
Gpr6	G	A	10: 41,071,172	S138L	possibly damaging	Het
Hesx1	C	A	14: 27,000,845	H42Q	possibly damaging	Het
Hsp90b1	T	C	10: 86,695,706	D421G	probably damaging	Het
Kctd19	T	C	8: 105,385,172	T31A	probably damaging	Het
Kif1b	G	A	4: 149,187,640	S1568L	possibly damaging	Het
Krtap19-3	T	C	16: 88,877,975		probably benign	Het
Lin28a	T	A	4: 134,018,154	I43F	probably benign	Het
Lrriq1	G	A	10: 103,214,857	T678I	probably benign	Het
Macf1	A	G	4: 123,368,815		probably benign	Het
Madcam1	A	G	10: 79,665,572	E157G	possibly damaging	Het
Mctp1	A	G	13: 76,824,822	D648G	probably damaging	Het
Megf8	T	C	7: 25,330,715	L425P	probably damaging	Het
Mospd4	A	G	18: 46,465,664		noncoding transcript	Het
Mybpc1	T	G	10: 88,551,452	T466P	probably damaging	Het
Myo10	T	C	15: 25,781,799	Y1127H	probably benign	Het
Myo18b	A	T	5: 112,831,078	L1223Q	probably damaging	Het
Myo9b	T	C	8: 71,333,699	Y670H	probably damaging	Het
Ndufaf4	G	T	4: 24,898,608	D55Y	probably damaging	Het
Neurod2	G	T	11: 98,327,588	A250E	possibly damaging	Het
Nipsnap1	C	A	11: 4,888,932	N119K	probably benign	Het
Npffr2	A	T	5: 89,568,065	I84F	probably damaging	Het
Olfr330	T	C	11: 58,529,611	D125G	probably damaging	Het
Olfr479	T	A	7: 108,055,904	N307K	probably benign	Het
Olfr748	A	G	14: 50,710,636	Y102C	probably damaging	Het
Pald1	A	G	10: 61,348,306		probably null	Het
Palld	T	C	8: 61,877,361	S161G	probably benign	Het
Paqr9	T	A	9: 95,561,069	F371I	probably benign	Het
Pear1	A	T	3: 87,758,359	C120*	probably null	Het
Pla2g4e	A	T	2: 120,182,811	F343I	probably damaging	Het
Plxdc2	A	T	2: 16,512,091	Y61F	probably benign	Het
Polh	G	A	17: 46,188,088	Q234*	probably null	Het
Prkce	T	A	17: 86,496,035	M454K	possibly damaging	Het
Proser1	C	A	3: 53,477,945	T416K	probably benign	Het
Prr14l	G	T	5: 32,831,828		probably benign	Het
Rabgap1l	A	T	1: 160,738,957	D90E	probably benign	Het
Rp1l1	T	A	14: 64,028,966	V667D	possibly damaging	Het
Rpp40	A	T	13: 35,898,621	C256*	probably null	Het
Rps6ka5	A	G	12: 100,678,538	L51P	probably damaging	Het
Rtp2	C	T	16: 23,927,707	C78Y	probably damaging	Het
Ryr3	A	G	2: 112,678,370		probably benign	Het
Slc10a6	A	G	5: 103,609,056	Y281H	probably benign	Het
Slc6a21	T	G	7: 45,282,773		probably null	Het
Slc9a3r1	A	T	11: 115,176,444	I174F	probably damaging	Het
Smo	A	G	6: 29,757,314	Y476C	probably damaging	Het
Tacr3	A	T	3: 134,854,860	T187S	probably damaging	Het
Tas1r3	G	A	4: 155,860,470	R765C	probably damaging	Het
Tasp1	T	C	2: 140,048,244	K71E	possibly damaging	Het
Tg	A	G	15: 66,694,894	I1264V	probably benign	Het
Tmem41a	T	C	16: 21,946,161		probably null	Het
Tmem63a	A	G	1: 180,965,540	N459D	probably benign	Het
Ube2k	A	G	5: 65,594,926	T151A	probably damaging	Het
Ubr1	T	C	2: 120,942,553	E402G	probably benign	Het
Ulk4	T	A	9: 121,152,182	I897F	probably benign	Het
Usp30	A	G	5: 114,111,163	E176G	probably damaging	Het
Utp20	A	G	10: 88,814,055	F431S	probably damaging	Het
Vmn1r206	T	C	13: 22,620,612	S142G	probably benign	Het
Wdr17	C	T	8: 54,632,381	V1236M	probably damaging	Het
Zbtb32	T	C	7: 30,591,493	K126E	possibly damaging	Het
Zeb1	A	T	18: 5,767,681	S731C	possibly damaging	Het

Other mutations in Clca1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00664:Clca1	APN	3	145027899	missense	probably benign	0.01
IGL00862:Clca1	APN	3	145024571	missense	possibly damaging	0.89
IGL00895:Clca1	APN	3	145024596	missense	probably damaging	1.00
IGL00969:Clca1	APN	3	145008958	missense	possibly damaging	0.80
IGL01398:Clca1	APN	3	145016751	missense	possibly damaging	0.81
IGL01447:Clca1	APN	3	145007778	missense	probably benign	0.00
IGL01455:Clca1	APN	3	145007778	missense	probably benign	0.00
IGL01457:Clca1	APN	3	145007778	missense	probably benign	0.00
IGL01458:Clca1	APN	3	145007778	missense	probably benign	0.00
IGL01462:Clca1	APN	3	145007778	missense	probably benign	0.00
IGL01473:Clca1	APN	3	145007778	missense	probably benign	0.00
IGL01488:Clca1	APN	3	145007778	missense	probably benign	0.00
IGL01490:Clca1	APN	3	145007778	missense	probably benign	0.00
IGL01632:Clca1	APN	3	145027441	missense	probably damaging	1.00
IGL01896:Clca1	APN	3	145015677	missense	possibly damaging	0.79
IGL02411:Clca1	APN	3	145028002	missense	possibly damaging	0.89
IGL03156:Clca1	APN	3	145013911	missense	probably damaging	1.00
R0472:Clca1	UTSW	3	145027345	missense	probably damaging	1.00
R0571:Clca1	UTSW	3	145007789	missense	probably damaging	1.00
R0585:Clca1	UTSW	3	145032625	missense	probably benign	0.16
R0586:Clca1	UTSW	3	145032589	missense	probably benign	0.45
R0791:Clca1	UTSW	3	145004854	missense	probably benign	0.01
R1187:Clca1	UTSW	3	145009743	missense	probably benign	0.30
R1713:Clca1	UTSW	3	145024546	missense	probably benign	0.00
R1739:Clca1	UTSW	3	145007778	missense	probably benign	0.00
R2079:Clca1	UTSW	3	145007773	missense	possibly damaging	0.80
R2178:Clca1	UTSW	3	145006102	missense	probably damaging	1.00
R2234:Clca1	UTSW	3	145009068	missense	possibly damaging	0.93
R2235:Clca1	UTSW	3	145009068	missense	possibly damaging	0.93
R2240:Clca1	UTSW	3	145008985	missense	probably damaging	1.00
R3751:Clca1	UTSW	3	145018663	missense	probably benign	0.01
R3974:Clca1	UTSW	3	145032639	missense	probably damaging	1.00
R3975:Clca1	UTSW	3	145032639	missense	probably damaging	1.00
R4409:Clca1	UTSW	3	145006027	missense	probably damaging	1.00
R4586:Clca1	UTSW	3	145016858	missense	probably damaging	1.00
R4751:Clca1	UTSW	3	145004848	missense	possibly damaging	0.89
R4894:Clca1	UTSW	3	145013901	missense	probably damaging	0.99
R4909:Clca1	UTSW	3	145024563	missense	probably damaging	1.00
R4916:Clca1	UTSW	3	145015844	missense	probably benign	0.01
R4941:Clca1	UTSW	3	145015653	missense	probably damaging	1.00
R4942:Clca1	UTSW	3	145004763	missense	probably benign	0.02
R5044:Clca1	UTSW	3	145007928	splice site	probably null
R5451:Clca1	UTSW	3	145027986	missense	probably damaging	1.00
R5618:Clca1	UTSW	3	145004977	missense	probably benign	0.00
R5724:Clca1	UTSW	3	145009072	missense	probably benign	0.01
R5898:Clca1	UTSW	3	145016761	missense	possibly damaging	0.89
R6238:Clca1	UTSW	3	145008955	missense	probably benign	0.09
R6590:Clca1	UTSW	3	145013883	missense	probably damaging	1.00
R6591:Clca1	UTSW	3	145013883	missense	probably damaging	1.00
R6592:Clca1	UTSW	3	145013883	missense	probably damaging	1.00
R6690:Clca1	UTSW	3	145013883	missense	probably damaging	1.00
R6691:Clca1	UTSW	3	145013883	missense	probably damaging	1.00
R6729:Clca1	UTSW	3	145005966	missense	probably damaging	1.00
R6805:Clca1	UTSW	3	145018667	missense	probably damaging	1.00
R7106:Clca1	UTSW	3	145027429	missense	probably damaging	0.98
R7121:Clca1	UTSW	3	145011806	missense	probably damaging	1.00
R7127:Clca1	UTSW	3	145006045	missense	probably damaging	1.00
R7212:Clca1	UTSW	3	145005966	missense	probably damaging	1.00
R7444:Clca1	UTSW	3	145027432	missense	probably damaging	1.00
R7446:Clca1	UTSW	3	145027427	missense	possibly damaging	0.65
R7535:Clca1	UTSW	3	145018567	missense	probably damaging	0.99
R8437:Clca1	UTSW	3	145005061	missense	probably benign	0.00
R8474:Clca1	UTSW	3	145005031	missense	possibly damaging	0.77
R8766:Clca1	UTSW	3	145009178	splice site	probably benign
R8884:Clca1	UTSW	3	145013996	missense	probably benign	0.35
R9049:Clca1	UTSW	3	145027382	missense	probably benign	0.01
R9306:Clca1	UTSW	3	145024578	missense	probably damaging	1.00
R9623:Clca1	UTSW	3	145013937	missense	probably benign	0.03
X0020:Clca1	UTSW	3	145032660	missense	possibly damaging	0.89
Z1176:Clca1	UTSW	3	145013921	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GGTCCTGGTCCAGATTGTATCATTC -3'
(R):5'- TAAGCCAGCAGACAAGCCTG -3'

Sequencing Primer
(F):5'- GGTCCAGATTGTATCATTCACACATC -3'
(R):5'- CCTGGGAGTGCAGAGACTG -3'

Posted On

2014-09-17