Incidental Mutation 'R0152:Arfip2'
ID22782
Institutional Source Beutler Lab
Gene Symbol Arfip2
Ensembl Gene ENSMUSG00000030881
Gene NameADP-ribosylation factor interacting protein 2
Synonyms2310002N04Rik, Arfaptin 2
MMRRC Submission 038435-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0152 (G1)
Quality Score225
Status Validated (trace)
Chromosome7
Chromosomal Location105634203-105640416 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 105637223 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 124 (T124M)
Ref Sequence ENSEMBL: ENSMUSP00000147995 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033171] [ENSMUST00000057525] [ENSMUST00000058333] [ENSMUST00000084782] [ENSMUST00000106780] [ENSMUST00000106783] [ENSMUST00000106784] [ENSMUST00000106785] [ENSMUST00000106786] [ENSMUST00000106789] [ENSMUST00000106791] [ENSMUST00000133519] [ENSMUST00000137931] [ENSMUST00000131446] [ENSMUST00000209550] [ENSMUST00000209445] [ENSMUST00000140577] [ENSMUST00000210350] [ENSMUST00000151193] [ENSMUST00000210312] [ENSMUST00000142363] [ENSMUST00000209588] [ENSMUST00000142874] [ENSMUST00000157028] [ENSMUST00000153371] [ENSMUST00000149819] [ENSMUST00000147044] [ENSMUST00000150479] [ENSMUST00000210911] [ENSMUST00000211054]
Predicted Effect probably benign
Transcript: ENSMUST00000033171
SMART Domains Protein: ENSMUSP00000033171
Gene: ENSMUSG00000030881

DomainStartEndE-ValueType
low complexity region 52 61 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000057525
SMART Domains Protein: ENSMUSP00000053384
Gene: ENSMUSG00000036989

DomainStartEndE-ValueType
RING 22 62 6.43e-8 SMART
BBOX 110 151 7.54e-14 SMART
BBC 158 284 2.55e-42 SMART
IG_FLMN 321 421 1.06e-31 SMART
Pfam:NHL 486 513 2.5e-9 PFAM
Pfam:NHL 533 560 1.9e-9 PFAM
Pfam:NHL 575 602 5.5e-8 PFAM
Pfam:NHL 622 649 1e-10 PFAM
Pfam:NHL 669 696 1.8e-12 PFAM
Pfam:NHL 713 740 1.9e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000058333
SMART Domains Protein: ENSMUSP00000057061
Gene: ENSMUSG00000089847

DomainStartEndE-ValueType
Pfam:zf-Tim10_DDP 2 67 8.1e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000084782
AA Change: T198M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000081840
Gene: ENSMUSG00000030881
AA Change: T198M

DomainStartEndE-ValueType
low complexity region 52 61 N/A INTRINSIC
low complexity region 65 81 N/A INTRINSIC
Arfaptin 89 316 1.72e-123 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106780
SMART Domains Protein: ENSMUSP00000102392
Gene: ENSMUSG00000089847

DomainStartEndE-ValueType
Pfam:zf-Tim10_DDP 2 67 8.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106783
SMART Domains Protein: ENSMUSP00000102395
Gene: ENSMUSG00000089847

DomainStartEndE-ValueType
Pfam:zf-Tim10_DDP 2 67 8.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106784
Predicted Effect probably benign
Transcript: ENSMUST00000106785
SMART Domains Protein: ENSMUSP00000102397
Gene: ENSMUSG00000110234

DomainStartEndE-ValueType
Pfam:zf-Tim10_DDP 2 67 3.8e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106786
SMART Domains Protein: ENSMUSP00000102398
Gene: ENSMUSG00000110234

DomainStartEndE-ValueType
Pfam:zf-Tim10_DDP 3 66 3.6e-18 PFAM
low complexity region 89 107 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106789
SMART Domains Protein: ENSMUSP00000102401
Gene: ENSMUSG00000036989

DomainStartEndE-ValueType
RING 22 62 6.43e-8 SMART
BBOX 110 151 7.54e-14 SMART
BBC 158 284 2.55e-42 SMART
IG_FLMN 321 421 1.06e-31 SMART
Pfam:NHL 486 513 1.8e-8 PFAM
Pfam:NHL 533 560 3.9e-10 PFAM
Pfam:NHL 575 602 2.3e-7 PFAM
Pfam:NHL 622 649 3.9e-10 PFAM
Pfam:NHL 669 696 2.2e-12 PFAM
Pfam:NHL 713 740 6.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106791
SMART Domains Protein: ENSMUSP00000102403
Gene: ENSMUSG00000036989

DomainStartEndE-ValueType
RING 22 62 6.43e-8 SMART
BBOX 110 151 7.54e-14 SMART
BBC 158 284 2.55e-42 SMART
IG_FLMN 321 421 1.06e-31 SMART
Pfam:NHL 486 513 3.4e-8 PFAM
Pfam:NHL 533 560 7.6e-10 PFAM
Pfam:NHL 575 602 4.4e-7 PFAM
Pfam:NHL 622 649 7.6e-10 PFAM
Pfam:NHL 669 696 2.7e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126589
Predicted Effect probably damaging
Transcript: ENSMUST00000133519
AA Change: T198M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000121649
Gene: ENSMUSG00000030881
AA Change: T198M

DomainStartEndE-ValueType
low complexity region 52 61 N/A INTRINSIC
low complexity region 65 81 N/A INTRINSIC
Arfaptin 89 209 5.49e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000137931
AA Change: R158C

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000118616
Gene: ENSMUSG00000030881
AA Change: R158C

DomainStartEndE-ValueType
low complexity region 52 61 N/A INTRINSIC
low complexity region 65 81 N/A INTRINSIC
Pfam:Arfaptin 89 153 1.1e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000131446
AA Change: T198M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120387
Gene: ENSMUSG00000030881
AA Change: T198M

DomainStartEndE-ValueType
low complexity region 52 61 N/A INTRINSIC
low complexity region 65 81 N/A INTRINSIC
Arfaptin 89 316 1.72e-123 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000209550
AA Change: T194M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000209445
Predicted Effect probably benign
Transcript: ENSMUST00000140577
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134613
Predicted Effect probably benign
Transcript: ENSMUST00000210350
Predicted Effect probably benign
Transcript: ENSMUST00000151193
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140385
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140882
Predicted Effect probably benign
Transcript: ENSMUST00000210312
Predicted Effect probably benign
Transcript: ENSMUST00000142363
Predicted Effect probably benign
Transcript: ENSMUST00000209588
Predicted Effect probably benign
Transcript: ENSMUST00000142874
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127759
Predicted Effect probably benign
Transcript: ENSMUST00000209870
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142173
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127853
Predicted Effect probably benign
Transcript: ENSMUST00000157028
Predicted Effect probably benign
Transcript: ENSMUST00000153371
SMART Domains Protein: ENSMUSP00000119910
Gene: ENSMUSG00000036989

DomainStartEndE-ValueType
RING 22 62 6.43e-8 SMART
BBOX 110 157 3.55e-10 SMART
Blast:BBC 164 199 9e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000149819
Predicted Effect probably benign
Transcript: ENSMUST00000147044
SMART Domains Protein: ENSMUSP00000114822
Gene: ENSMUSG00000036989

DomainStartEndE-ValueType
RING 22 62 6.43e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150479
Predicted Effect probably damaging
Transcript: ENSMUST00000210911
AA Change: T124M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000210893
Predicted Effect probably benign
Transcript: ENSMUST00000211054
Meta Mutation Damage Score 0.2483 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.3%
  • 20x: 89.5%
Validation Efficiency 87% (40/46)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass T C 6: 23,074,689 D834G probably damaging Het
Abca13 T A 11: 9,581,724 H4650Q probably damaging Het
Aqr T A 2: 114,159,010 T111S probably benign Het
Arhgap44 G T 11: 65,011,919 A574E probably benign Het
Arhgef26 T C 3: 62,423,544 S560P probably damaging Het
Car5a T A 8: 121,916,446 N273I probably damaging Het
Cd4 G A 6: 124,867,746 Q359* probably null Het
Cgrrf1 G A 14: 46,853,913 C298Y probably damaging Het
Clip3 G A 7: 30,303,432 A416T probably benign Het
Dst C T 1: 34,189,119 P1606L probably damaging Het
Eif3e G A 15: 43,252,236 A378V possibly damaging Het
Ercc6 C G 14: 32,546,905 probably benign Het
Eri2 A G 7: 119,790,383 V104A probably damaging Het
Exph5 T A 9: 53,353,204 probably null Het
Hmcn1 A T 1: 150,663,879 Y2954N probably benign Het
Itga2 C T 13: 114,866,314 G547R probably benign Het
Kbtbd11 T C 8: 15,027,428 V9A probably damaging Het
Ldb2 T C 5: 44,541,799 D99G possibly damaging Het
Mfsd12 G T 10: 81,357,799 D68Y probably damaging Het
Mgarp T C 3: 51,388,963 D228G probably benign Het
Myh14 A T 7: 44,623,181 L1441Q probably damaging Het
Obscn T C 11: 59,052,576 D4810G probably benign Het
Olfr1331 T A 4: 118,868,886 I34N possibly damaging Het
Olfr1448 A G 19: 12,920,108 V67A possibly damaging Het
Olfr293 A T 7: 86,664,511 Y283F probably damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr948 A G 9: 39,319,461 I51T probably benign Het
Pdhx A G 2: 103,028,280 V393A probably benign Het
Pdpk1 C T 17: 24,106,946 R92H possibly damaging Het
Pgr A T 9: 8,965,022 I889F probably benign Het
Pum2 T A 12: 8,728,754 I468K possibly damaging Het
Recql5 A G 11: 115,894,673 S666P probably benign Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc26a4 T C 12: 31,529,498 I588M probably damaging Het
Slc9a2 A G 1: 40,742,804 T398A probably damaging Het
Snapc1 C T 12: 73,975,032 R81C probably damaging Het
Tub A T 7: 109,020,927 N93Y probably damaging Het
Usp3 T C 9: 66,540,150 T181A probably damaging Het
Vars2 A G 17: 35,660,027 L637P probably damaging Het
Vmn2r1 T C 3: 64,081,819 S60P possibly damaging Het
Wdcp A G 12: 4,851,583 S480G probably benign Het
Zbtb38 T C 9: 96,686,280 Y917C probably damaging Het
Zfp68 T C 5: 138,606,613 K445E probably damaging Het
Zmynd10 A G 9: 107,550,945 probably null Het
Other mutations in Arfip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02105:Arfip2 APN 7 105639383 missense probably damaging 1.00
IGL03192:Arfip2 APN 7 105637943 missense probably damaging 1.00
IGL03299:Arfip2 APN 7 105637943 missense probably damaging 1.00
R0096:Arfip2 UTSW 7 105638230 missense probably damaging 1.00
R0121:Arfip2 UTSW 7 105636371 missense probably damaging 1.00
R0130:Arfip2 UTSW 7 105638998 unclassified probably benign
R0317:Arfip2 UTSW 7 105637223 missense probably damaging 1.00
R2172:Arfip2 UTSW 7 105637988 missense probably damaging 1.00
R4419:Arfip2 UTSW 7 105639063 missense probably damaging 1.00
R4926:Arfip2 UTSW 7 105637944 missense probably damaging 1.00
R5394:Arfip2 UTSW 7 105636976 nonsense probably null
R5637:Arfip2 UTSW 7 105637163 missense probably damaging 1.00
Z1088:Arfip2 UTSW 7 105637242 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCATCATATTCCAGCCTGGGAAG -3'
(R):5'- GCCAAGGGACCCTACTAACTTTGTG -3'

Sequencing Primer
(F):5'- CTTTCCTTTCTGAATCTGTATGCC -3'
(R):5'- GGACCCTACTAACTTTGTGGCTAAG -3'
Posted On2013-04-16